Busch Lab

ZMP

ACYP2

Ensembl ID:
ENSDARG00000086271
Description:
acylphosphatase 2, muscle type [Source:HGNC Symbol;Acc:180]
Human Orthologue:
ACYP2
Human Description:
acylphosphatase 2, muscle type [Source:HGNC Symbol;Acc:180]
Mouse Orthologue:
Acyp2
Mouse Description:
acylphosphatase 2, muscle type Gene [Source:MGI Symbol;Acc:MGI:1922822]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9872 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125368 Essential Splice Site 44 87 1 3
Genomic Location (Zv9):
Chromosome 11 (position 44258123)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42812261
GRCz11 11 43104342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGTGACAAATATGTGTCTGTAGATTTCGAGGTGTTCGGGAATGTTCAGG[G/T]TRGGTGTCTCAGTGTGTTTTRCAAACTTGGCGACCACGCCTCCAAAAATA
Associated Phenotype:
Not determined