Busch Lab

ZMP

LOC566196

Ensembl ID:
ENSDARG00000086261
Human Orthologue:
FHDC1
Human Description:
FH2 domain containing 1 [Source:HGNC Symbol;Acc:29363]
Mouse Orthologue:
Fhdc1
Mouse Description:
FH2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2684972]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42583 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42583
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122848 Nonsense 435 752 11 11
Genomic Location (Zv9):
Chromosome 15 (position 31533170)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32428822
GRCz11 15 32286801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGTTCTCAAAATGCAGCCAAGCGACGCTCCACTGCCACCTGCTCCTCA[C/T]GAGACAAGGACATTGAAGGAGCTGCTTTGGAGTCCATTCTACAGAGGTTC
Long Flanking Sequence:
GGGAATGGTTTTTTCTGGAAAAATGATGGAACGTCCGTGTCTGTGTGAACACCTTTTTTATGAATTTACCGGTAAAGTCATACTGGAATTTTTGGATATTTACCAGTATCACTGTGTGAAAGGGGCTAATGGCTGTTATTCTTAAGTATTTCTTCTTCGGGTTCAGCAGAAGAAAGAAAATCAAACAGTTTTGGAACAAGTGGAGAATGAGTAAACGAAATTCATTTTAGAGTGAACTATCAGAAATTAGGGAAAAAAATTAACAGGGGGGCTAATAGTTCTGACTTCAACTTTACATATATATATATACAGTATATATATATATATATATATATATATAATGGTTATATTTGACTTTAGAAAAGGTGTAAGAACTATGTTTACATGTCCTCTCTCTGCTTTAGGAGAACCTCGATCGAGACATACTGGAAGTGAAGCGCAGGCAGCGAGAGGGTTCTCAAAATGCAGCCAAGCGACGCTCCACTGCCACCTGCTCCTCA[C/T]GAGACAAGGACATTGAAGGAGCTGCTTTGGAGTCCATTCTACAGAGGTTCAACAGTCGCCAGTCCCGTCGCAGAGCAGGAAATGCTTCACCCACACTAGGGAACCTTACTGACATCCTCCAGGAAAATCGTCCCGCTGACAGGGCGGTCAAAAGAGACAGTTGGATCAAAGGTGCCCTGCAATCCTCTGTGATCAAGGAGAGCTTTGAAAGGGAAGAGATGCCTAAAAACCCACAGATTACAATCTCAAGCCCGGCGCATGAAACCCCCAGTACCCCCAATTCCACAGTCAATCAGAGACTCTCGGTAACAACAGAGCAGGATGAGGATGATGTTCAGACTGAGAAGGAGGTGCGCAATATGAGAGAGGTGTCAAGGAAAGTTTTACAATACCAGTCTAGTAAAAGCAGCATTTCATCTGGCGAGGCCCTTTCACCGCTCCTGTCTCCACGCCAGACATTCTTCCAGGAAGACAGAAGACAGCTGCTCATAGTAGCCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7765
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122848 Nonsense 517 752 11 11
Genomic Location (Zv9):
Chromosome 15 (position 31533417)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32429069
GRCz11 15 32287048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGAGCTTTGAAAGGGAMGAGATGCCTAAAAACCCACAGATTACAATCT[C/A]AAGCCCGGCGCATGAAACCCCCAGTACCCCCAATTCCACAGTCARTCARA
Long Flanking Sequence:
TAGGGAAAAAAATTAACAGGGGGGCTAATAGTTCTGACTTCAACTTTACATATATATATATACAGTATATATATATATATATATATATATATAATGGTTATATTTGACTTTAGAAAAGGTGTAAGAACTATGTTTACATGTCCTCTCTCTGCTTTAGGAGAACCTCGATCGAGACATACTGGAAGTGAAGCGCAGGCAGCGAGAGGGTTCTCAAAATGCAGCCAAGCGACGCTCCACTGCCACCTGCTCCTCACGAGACAAGGACATTGAAGGAGCTGCTTTGGAGTCCATTCTACAGAGGTTCAACAGTCGCCAGTCCCGTCGCAGAGCAGGAAATGCTTCACCCACACTAGGGAACCTTACTGACATCCTCCAGGAAAATCGTCCCGCTGACAGGGCGGTCAAAAGAGACAGTTGGATCAAAGGTGCCCTGCAATCCTCTGTGATCAAGGAGAGCTTTGAAAGGGAAGAGATGCCTAAAAACCCACAGATTACAATCT[C/A]AAGCCCGGCGCATGAAACCCCCAGTACCCCCAATTCCACAGTCAATCAGAGACTCTCGGTAACAACAGAGCAGGATGAGGATGATGTTCAGACTGAGAAGGAGGTGCGCAATATGAGAGAGGTGTCAAGGAAAGTTTTACAATACCAGTCTAGTAAAAGCAGCATTTCATCTGGCGAGGCCCTTTCACCGCTCCTGTCTCCACGCCAGACATTCTTCCAGGAAGACAGAAGACAGCTGCTCATAGTAGCCATAGAAGAAAACACTGCAAACTCCAGCTCTCTGTTGCAAAACAGCCAGATCATCAACCGCCGGCACACGATCTCACTTCCCGAAGCCAACTGTGGAAACGCCAGCCAAGAGGACATATTCGTGCCGTGCAATCTGAATGCATCTCCGGCTCCCTCTATAGATGCTATTGGGAAGGTGAAATCTTTGGATAGTGCTATACTTTCCACACAACAGAACTCTACTGTTAAAGACTCCAATTCTCAAAACGAAT
Associated Phenotype:
Not determined