Busch Lab

ZMP

si:ch211-236p5.2

Ensembl ID:
ENSDARG00000086256
ZFIN ID:
ZDB-GENE-081028-33
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36322
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128105 Nonsense 13 959 1 8
ENSDART00000145668 Nonsense 14 639 1 1
Genomic Location (Zv9):
Chromosome 17 (position 8117617)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8120391
GRCz11 17 8277569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTCTGCAGACTGAAGAGAGATGCTGCTGTCAGATCAGTGACTGAC[C/T]AACACAAATCATCCATGAAGGACAAATACGAGTTATTTGAGGGAATCAAT
Associated Phenotype:
Not determined