Busch Lab

ZMP

ENSDARG00000086250

Ensembl ID:
ENSDARG00000086250
Human Orthologue:
PRKCA
Human Description:
protein kinase C, alpha [Source:HGNC Symbol;Acc:9393]
Mouse Orthologue:
Prkca
Mouse Description:
protein kinase C, alpha Gene [Source:MGI Symbol;Acc:MGI:97595]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33099 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130154 Essential Splice Site 100 312 3 8
Genomic Location (Zv9):
Chromosome 3 (position 10867059)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56209079
GRCz11 3 56276511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCATCCGCTCCTCGCTCAACCCCACCTGGAACGAGTCCTTCATCTTG[T/A]GAGTCTGAGCTAAACACACATACACACATACTTGTTTGATTTATGAGGAC
Associated Phenotype:
Not determined