Busch Lab

ZMP

si:ch211-244h7.4

Ensembl ID:
ENSDARG00000086248
ZFIN ID:
ZDB-GENE-050420-256
Description:
hypothetical protein LOC569137 [Source:RefSeq peptide;Acc:NP_001038641]
Human Orthologue:
KCNJ1
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 1 [Source:HGNC Symbol;Acc:6255]
Mouse Orthologue:
Kcnj1
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927248

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6535 Nonsense Mutation detected in F1 DNA Not yet available
sa130 Nonsense Confirmed mutation in F2 line Not yet available
sa23386 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6535
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032336 Nonsense 45 368 1 1
ENSDART00000143645 Nonsense 45 368 2 2
Genomic Location (Zv9):
Chromosome 18 (position 47080163)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48521854
GRCz11 18 48516551
KASP Assay ID:
554-4809.1 (used for ordering genotyping assays)
KASP Sequence:
CGCTGCAACATTGAGTTYGACAATGTGATGCACAGAAACCGATTCGCCTA[T/A]GTCCGCGACTTCTGGACCACCTTCGTGGAGACCMGATGGCGGTTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa130
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032336 Nonsense 91 368 1 1
ENSDART00000143645 Nonsense 91 368 2 2
Genomic Location (Zv9):
Chromosome 18 (position 47080026)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48521717
GRCz11 18 48516414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCTTCGGACTCATCTGGTACTGGTTAGCAAGAAGCAATGGTGACCTGT[T/A]GTGGCAGAATCCACCACCAGATCATAAACCATGCGTTTACAGCGTTTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23386
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032336 Nonsense 155 368 1 1
ENSDART00000143645 Nonsense 155 368 2 2
Genomic Location (Zv9):
Chromosome 18 (position 47079833)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48521524
GRCz11 18 48516221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTGATTATAATCCAGACTATTATAGGAATCTTAATCGGTATATTCTG[G/A]TGTGGTATAGTTATAACCAAAATCACCCTTCCAAAAAAGAGAGCCAAAAC
Associated Phenotype:
Not determined