Busch Lab

ZMP

si:dkey-32o22.2

Ensembl ID:
ENSDARG00000086215
ZFIN ID:
ZDB-GENE-081104-409
Human Orthologue:
GPR156
Human Description:
G protein-coupled receptor 156 [Source:HGNC Symbol;Acc:20844]
Mouse Orthologue:
Gpr156
Mouse Description:
G protein-coupled receptor 156 Gene [Source:MGI Symbol;Acc:MGI:2653880]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10879 Nonsense Available for shipment Available now
sa25418 Nonsense Mutation detected in F1 DNA Not yet available
sa34566 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128704 Nonsense 460 800 9 9
ENSDART00000139138 None None 161 None 4
ENSDART00000147378 None None 136 None 2
Genomic Location (Zv9):
Chromosome 9 (position 9901934)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9702485
GRCz11 9 9680522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCCACCTCCCTATGTACCTCCTCCACCAATTCCCATCCAYACTACCT[C/A]AARTGCAAMATCCCCTGAAGGTCCAGGAGCTACAGATRAGTCTTCACCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128704 Nonsense 697 800 9 9
ENSDART00000139138 None None 161 None 4
ENSDART00000147378 None None 136 None 2
Genomic Location (Zv9):
Chromosome 9 (position 9901224)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9701775
GRCz11 9 9679812
KASP Assay ID:
554-7333.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGAGGAGTAAAAGGGCAGAGAAAGCACAGACTCAGAGCAACTCAGGA[C/T]AGGACAGTTGGCAATGTTCTTCTCACAAATGTTCGATTACTCCTTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34566
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128704 Nonsense 737 800 9 9
ENSDART00000139138 None None 161 None 4
ENSDART00000147378 None None 136 None 2
Genomic Location (Zv9):
Chromosome 9 (position 9901102)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9701653
GRCz11 9 9679690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCTGGACTGATAGAGGAGGTTAAACACTCTAAGGAGCCATATGACTA[T/A]TCAGACTCAGACTCCAGCAGCTCGGAGGACTACTGTTACTACCAGCGGTC
Associated Phenotype:
Not determined