Busch Lab

ZMP

grin2da

Ensembl ID:
ENSDARG00000086207
ZFIN ID:
ZDB-GENE-041008-124
Description:
Novel protein similar to vertebrate glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D)
Human Orthologue:
GRIN2D
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2D [Source:HGNC Symbol;Acc:4588]
Mouse Orthologue:
Grin2d
Mouse Description:
glutamate receptor, ionotropic, NMDA2D (epsilon 4) Gene [Source:MGI Symbol;Acc:MGI:95823]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36789 Nonsense Mutation detected in F1 DNA Not yet available
sa36788 Nonsense Mutation detected in F1 DNA Not yet available
sa45662 Nonsense Mutation detected in F1 DNA Not yet available
sa13750 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36789
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 Nonsense 123 364 2 6
ENSDART00000121651 None None 554 None 3
ENSDART00000128837 Nonsense 337 1886 3 13
Genomic Location (Zv9):
Chromosome 19 (position 10612720)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10071259
GRCz11 19 9990184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCCAAGGCTCTGTTCGCTGTGCGACCCCAAGGATGGAGGGACGAGCCA[C/T]GACGGCGGATCGCAAAAGGTGTATCAGTACTGACGCACGGTGCTATGGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4789
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 None None 364 None 6
ENSDART00000121651 Essential Splice Site 74 554 2 3
ENSDART00000128837 Essential Splice Site 912 1886 12 13
Genomic Location (Zv9):
Chromosome 19 (position 10541595)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10000134
GRCz11 19 9919059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTTTAGGCCGGACAAGAGGACTTGACTTCTTACTGGCTTTTAGTCGG[G/A]TGAGTGTCCCTAATAAATCTTGTTGTACTATAAATGTTAGAGCTGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36788
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 None None 364 None 6
ENSDART00000121651 Nonsense 79 554 3 3
ENSDART00000128837 Nonsense 917 1886 13 13
Genomic Location (Zv9):
Chromosome 19 (position 10540207)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9998746
GRCz11 19 9917671
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTAAATAAATTTTTCGCTTGTTATCTCTTACAGGGAATGTACAGCTG[C/A]TGCAATTTCGAGGATGAAACAGCTCCTGGAGGTTCCCAAAGCACACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 None None 364 None 6
ENSDART00000121651 Nonsense 131 554 3 3
ENSDART00000128837 Nonsense 969 1886 13 13
Genomic Location (Zv9):
Chromosome 19 (position 10540053)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9998592
GRCz11 19 9917517
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACGGCTGTGGCCAATCCCCCTATTGCTATGGCACAACAACTGCCGCAG[C/T]AGCAACAAAAGCAACACCACCAGCAGCCACCAGTCTACAGTGCTCTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13750
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 None None 364 None 6
ENSDART00000121651 Nonsense 132 554 3 3
ENSDART00000128837 Nonsense 970 1886 13 13
Genomic Location (Zv9):
Chromosome 19 (position 10540050)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9998589
GRCz11 19 9917514
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGCTGTGGCCAATCCCCCTATTGCTATGGCACAACAACTGCCGCARCAG[C/T]AACAAAAGCAACACCACCAGCAGCCACCAGTCTACAGTGCTCTTCTTYCT
Associated Phenotype:
Not determined