Busch Lab

ZMP

ENSDARG00000086202

Ensembl ID:
ENSDARG00000086202

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38199 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa44413 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38199
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123791 Splice Site, Nonsense 4 187 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA584 (position 7311)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150359.1 7311
GRCz11 14 1453539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATTCCTGTTTGATTTTGTTTTAGTTCATTTTACTGATCATGGACCAA[G/T]GTAGGACAACTTTTCATTTAGCTTTTGTCAGGTTTTCTATATTTCTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44413
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123791 Nonsense 127 187 4 4
Genomic Location (Zv9):
Chromosome Zv9_NA584 (position 283)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150359.1 283
GRCz11 14 1446511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCCTGTTTCAGTTTTGACCTGGTCTTCTCTAATTGGCTGTTGATGTA[T/A]CTGAGTGACCAGGAACTGCAGTTATTGGCTGAGAAGTTCCTCAGGTGGCT
Associated Phenotype:
Not determined