Busch Lab

ZMP

ENSDARG00000086130

Ensembl ID:
ENSDARG00000086130

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33504 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33504
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127767 Essential Splice Site 60 320 3 8
Genomic Location (Zv9):
Chromosome 4 (position 52293507)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 47447740
GRCz11 4 49263146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTTTTACATTATTGCTCACATCAACAGTTTTGTGTAAACCAACAA[T/C]TCAGTAAAGAGAGTCATTCCTGAATAAATCAGTTGTTTAAAATAATCAAA
Associated Phenotype:
Not determined