Busch Lab

ZMP

si:ch1073-446e18.3

Ensembl ID:
ENSDARG00000086075
ZFIN ID:
ZDB-GENE-090313-3
Human Orthologue:
TTC3
Human Description:
tetratricopeptide repeat domain 3 [Source:HGNC Symbol;Acc:12393]
Mouse Orthologue:
Ttc3
Mouse Description:
tetratricopeptide repeat domain 3 Gene [Source:MGI Symbol;Acc:MGI:1276539]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa21623 Essential Splice Site Available for shipment Available now
sa17296 Essential Splice Site Available for shipment Available now
sa21624 Nonsense Available for shipment Available now
sa31756 Nonsense Available for shipment Available now
sa30648 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21623
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 Essential Splice Site 22 456 1 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 None None 1168 None 27
ENSDART00000127228 Essential Splice Site 22 456 1 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 None None 1168 None 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 174903)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 108885
GRCz11 10 108885
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGATCTGGAGGAAGGACCCAATGTTCAGAGGCACAAAACCAAGATTG[T/A]GAGTATATTTCAGTCATTTATTGCTTTCACAGCAGTGGCGAGGACAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17296
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 Essential Splice Site 22 456 1 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 None None 1168 None 27
ENSDART00000127228 Essential Splice Site 22 456 1 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 None None 1168 None 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 174903)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 108885
GRCz11 10 108885
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAGATCTGGAGGAAGGACCCAATGTTCAGAGGCACAAAACCAARATTG[T/C]GAGTATATTTCAGTCATTTATTGCTTTCACAGCAGTGGCGAGGACAGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27520
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 Nonsense 142 456 6 16
ENSDART00000145716 Nonsense 105 295 4 9
ENSDART00000146125 None None 1168 None 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 179711)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 104077
GRCz11 10 104077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACCTGATGAGGCTCACCCGTCTGTCTGTGTGTGCAGGAGGAGGACTG[T/A]CTGACTGAGGCCATACGCTGGCTGCTGGACTCTGGAGATCCTGACCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 Nonsense 228 456 8 16
ENSDART00000145716 Nonsense 191 295 6 9
ENSDART00000146125 None None 1168 None 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 182422)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 101366
GRCz11 10 101366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGATGAAATGAAGAACAAAGGAAACGAGCACTTTCAGAAGAAGAAATA[T/G]GACGTTGCCTTAAAGTGGTACTCTAAAGCCATTAAATACCAGTGAGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31756
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 Nonsense 384 456 14 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 None None 1168 None 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 186699)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 97089
GRCz11 10 97089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAAGTCTCATCACTGTACTGTTGTTTTTCCTCCAGAAATCTGAAAAG[C/T]AGAAACAGCAGGCGGACACTTCAGGTGAGCTGAATAAGATTCTGAACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30648
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 None None 456 None 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 Essential Splice Site 75 1168 3 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 190090)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 93698
GRCz11 10 93698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGCGCTGATCTGCATTCTCGGCCCCGC[A/G]GGAGCACCTGGAGAGCCTGGTGGAGGTGTGCAGGTTTCCTCCTAAAGCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27521
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127228 None None 456 None 16
ENSDART00000145716 None None 295 None 9
ENSDART00000146125 Essential Splice Site 717 1168 16 27

The following transcripts of ENSDARG00000086075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 196911)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 86877
GRCz11 10 86877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGC[A/G]GGGTGAGCTGATGGGCTTGCAGAAGCGTCGGCTGTATCTGCTGGAGGAGC
Associated Phenotype:
Not determined