Busch Lab

ZMP

ENSDARG00000086060

Ensembl ID:
ENSDARG00000086060
Human Orthologues:
HMCN2, RP11-88G17.6
Human Descriptions:
Novel protein similar to hemicentin (LOC392395) [Source:UniProtKB/TrEMBL;Acc:A2A3K3]
hemicentin 2 [Source:HGNC Symbol;Acc:21293]
Mouse Orthologue:
Hmcn2
Mouse Description:
hemicentin 2 Gene [Source:MGI Symbol;Acc:MGI:2677838]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13006 Nonsense Available for shipment Available now
sa41251 Nonsense Mutation detected in F1 DNA Not yet available
sa41252 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 43 1126 1 22
Genomic Location (Zv9):
Chromosome 8 (position 33471754)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32614480
GRCz11 8 32623712
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCCAAAGACTATCGGCTGAAGAGAGACGTTCTCCAGTTAGTACAGCTA[C/T]GACAGTCTCAGGTACCTGTTTYAGTCTTATTGCAATTCTTTTACAATAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5492
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 744 1126 15 22
Genomic Location (Zv9):
Chromosome 8 (position 33528008)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32670734
GRCz11 8 32679966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGTTTCTCTGATCCCTCCAGGTGTTTGGGTTGATGATGAAGGTGTTTA[T/A]CTTTGCGAGGCCAAAAACCAGTTCGGATCTATCAAGGCATTAGCGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41251
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 803 1126 16 22
Genomic Location (Zv9):
Chromosome 8 (position 33528269)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32670995
GRCz11 8 32680227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTTCCCTGTAGGTTATTAGATGGGATTCCTCTCCCTGAAAGGATCTG[G/A]ACACACAATGGGAAACAAGTGAGTAACAAAAATGAGTTCATTTCACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41252
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Essential Splice Site 858 1126 18 22
Genomic Location (Zv9):
Chromosome 8 (position 33530623)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32673349
GRCz11 8 32682581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGGTTGTTAAGGTCTGGTCAACAGCTGCTATTTTGACCTACTTTTGC[A/T]GCCCCTCCTGATATCAAGGCTGGTCCCCTGCACTACACAGCTAGCGAGGG
Associated Phenotype:
Not determined