Busch Lab

ZMP

LOC794425

Ensembl ID:
ENSDARG00000086047
Human Orthologues:
CYLC1, CYLC2
Human Descriptions:
cylicin, basic protein of sperm head cytoskeleton 1 [Source:HGNC Symbol;Acc:2582]
cylicin, basic protein of sperm head cytoskeleton 2 [Source:HGNC Symbol;Acc:2583]
Mouse Orthologues:
Cylc1, Cylc2
Mouse Descriptions:
cylicin, basic protein of sperm head cytoskeleton 1 Gene [Source:MGI Symbol;Acc:MGI:1914657]
cylicin, basic protein of sperm head cytoskeleton 2 Gene [Source:MGI Symbol;Acc:MGI:1922164]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28549
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126048 Nonsense 122 207 5 7
Genomic Location (Zv9):
Chromosome 15 (position 45635424)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46068890
GRCz11 15 46283837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGTCTGGATCTTCAGGTCTGGAGCGACTCACTGAATTCACTCTAGCT[G/T]GAGAAAACAAAACAGACAAGAAGAAGAAGAAACGCAAAGTAATTTATTCC
Long Flanking Sequence:
TAGCACTGTGGCCTTACAGCAAGAAGATTGCTGGTTCGAGTCCTGGCTGGGTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCCACCGTGTTGGCGTGGGTTTCGTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAACACATGCGCTATAGGGGAACTGATGAACTAAACTGTCCGTAGTGTATGAGTGTGTATGGGTGTTTCCCAGTACTGGGTTGCAGATGGAAGGGCATCCGCTGTGTAAAACAAATGCTGGAATAGTTGGAAGTTCATTCCGCTGTGATGACCCCTGATAAATAAGGGACTAAGCCGAAGGAGAATGAATAAACAGAAGTATATGCACGTTATTAGTGAAGTTTGATTTGTATAATTGGTCAGAGGTGTATTAGTATGACAGGAGAAGCACACGTTTCCCAGTGTTTTCTTTTATGTTTGCATGTATGATGACATCTGGTCTGGATCTTCAGGTCTGGAGCGACTCACTGAATTCACTCTAGCT[G/T]GAGAAAACAAAACAGACAAGAAGAAGAAGAAACGCAAAGTAATTTATTCCTTCTATAAGATTCTTACCATTTTATTAGTAGTAGTAGTGGTAGCATCATATTTTAATTAATTGAAGATTATTTATAAACTAATGTCGAGAGGATCATGTGCTTGTGATTGCTTGCAGCCAGTCCCGCATTATTAAATTTATTATTCACCAATGAGACGATTCCTAAGCCATTATAAATACCCTCAGCTCCATATCACAGCCATCATCTTCGTTTTGAAGAATCCCCCCTTCCACTCCTACTCCTCCTCCTTTCCTAGATGGGTGGCACGGTGGCCCAGTGCTTAGCACTGTTGCCTCACAGCAAGAACGTCACTGGTTCTAGTCCTTACCAAGCCAGCTGACATTCCTGTGTGGAGTTTACACGTTCTCCCCGCGCTCACGTGGGTTTCCCCCGGGTTCCCCGGTTTCCTCCCACCATCCAAAACATGCAACTTAAGTTAATCGACTAAT
Associated Phenotype:
Not determined