Busch Lab

ZMP

si:ch73-389o21.2

Ensembl ID:
ENSDARG00000083189
ZFIN ID:
ZDB-GENE-100922-157
Human Orthologue:
ARHGAP19
Human Description:
Rho GTPase activating protein 19 [Source:HGNC Symbol;Acc:23724]
Mouse Orthologue:
Arhgap19
Mouse Description:
Rho GTPase activating protein 19 Gene [Source:MGI Symbol;Acc:MGI:1918335]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37564 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30733 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37564
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116455 Essential Splice Site 130 454 3 12
ENSDART00000133537 Essential Splice Site 130 454 3 11
Genomic Location (Zv9):
Chromosome 22 (position 37809541)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34994421
GRCz11 22 34970170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGGAATAGCCCAGATATATCAGCTCATCGCTTACCTCAGCAAAA[G/A]TAAGTGCATGATATTAATAAAGTTGATGGCTTTATTATACAGTTCACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30733
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116455 Nonsense 301 454 6 12
ENSDART00000133537 Nonsense 301 454 6 11
Genomic Location (Zv9):
Chromosome 22 (position 37805680)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34990560
GRCz11 22 34966309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACCTGAAGAAGCTCAACAGCGGGATGGCGTTTCTCATCAAACACTCA[C/T]AGAAGATCTTTAGGGTATCTTTTCAGATCAAACCTTTTCTCACTGCAGCT
Associated Phenotype:
Not determined