Busch Lab

ZMP

si:dkey-71b5.7

Ensembl ID:
ENSDARG00000080675
ZFIN ID:
ZDB-GENE-100922-124
Human Orthologue:
OTOA
Human Description:
otoancorin [Source:HGNC Symbol;Acc:16378]
Mouse Orthologue:
Otoa
Mouse Description:
otoancorin Gene [Source:MGI Symbol;Acc:MGI:2149209]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7423 Missense Mutation detected in F1 DNA Not yet available
sa45573 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17950 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28646
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Nonsense 242 1151 7 26
ENSDART00000145100 None None 405 None 10
Genomic Location (Zv9):
Chromosome 16 (position 24189667)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22194161
GRCz11 16 21998413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTCCTGCCAAAATGCTCTGGCTGAAAGCTAAAATGTTGTCAATGATG[G/T]GACCTTTTCTGTCCAGCCTTCCCATCGAGGAAGTAAAAAATATCCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7423
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Missense 695 1151 17 26
ENSDART00000145100 Missense 166 405 5 10
Genomic Location (Zv9):
Chromosome 16 (position 24149753)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22154247
GRCz11 16 21958499
KASP Assay ID:
554-4078.1 (used for ordering genotyping assays)
KASP Sequence:
CCCTTTGGTGTGTGAATTAGACCCGGTYTGGATCTCCTCTCTGAACCCTG[C/A]AGCTCGCAACGCCACCCTGAAGTCTCTGGCATCCTGTCAGTACATCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45573
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Essential Splice Site 925 1151 21 26
ENSDART00000145100 Essential Splice Site 396 405 9 10
Genomic Location (Zv9):
Chromosome 16 (position 24146051)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22150545
GRCz11 16 21954797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGGACACATTGGAGATACTGGCCAACTGTAACTTTACACAGACACAG[G/A]TAATTCAAGCATAAATACATTCAGTCAATATCTTTAAAAAAAAAAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17950
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Essential Splice Site 1019 1151 23 26
ENSDART00000145100 None None 405 None 10
Genomic Location (Zv9):
Chromosome 16 (position 24144338)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22148832
GRCz11 16 21953084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGAAAACTGGACTGAAGCTCAGATCTGCATAATGGGGAACATCATTGG[T/A]GAGGAAATTTACCAGTGGATTACGCTTAAATACTTACATGTTGAAGTTTG
Associated Phenotype:
Not determined