Busch Lab

ZMP

si:dkey-38k3.2

Ensembl ID:
ENSDARG00000080018
ZFIN ID:
ZDB-GENE-070424-241
Description:
Novel kinesin motor domain containing protein [Source:UniProtKB/TrEMBL;Acc:A5PMW8]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa35544 Essential Splice Site Available for shipment Available now
sa11558 Nonsense Available for shipment Available now
sa15752 Nonsense Available for shipment Available now
sa35543 Nonsense Mutation detected in F1 DNA Not yet available
sa15751 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35544
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Essential Splice Site 117 1309 4 19
ENSDART00000131543 Essential Splice Site 78 433 2 11
Genomic Location (Zv9):
Chromosome 13 (position 34904937)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34555986
GRCz11 13 34681992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATGGCCAAACAGGCTCAGGAAAAACCTACACCATGATGGGCAACCCG[G/A]TTTGTATCCCATCTCATTACTGTCTCTATCCCAAGTGTAATTTCAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11558
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Nonsense 308 1309 9 19
ENSDART00000131543 Nonsense 269 433 7 11
Genomic Location (Zv9):
Chromosome 13 (position 34894035)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34545084
GRCz11 13 34671090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCTGTCTGTCAGTGGTGGAATAAAAAGAAAGCAAAGCTTTGTTCCATA[T/G]AGAGACTCTGTGCTTACCTGGCTTCTAAAGGACAGTCTTGGTGGGAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15752
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Nonsense 315 1309 9 19
ENSDART00000131543 Nonsense 276 433 7 11
Genomic Location (Zv9):
Chromosome 13 (position 34894014)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34545063
GRCz11 13 34671069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAAAAGAAAGCAAAGCTTTGTTCCATAKAGAGAMTCTGTGCTTACCTG[G/A]CTTCTAAAGGACAGTCTTGGTGGGAACTCCAAAACCAWCATGATAGCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7732
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Nonsense 442 1309 13 19
ENSDART00000131543 Nonsense 403 433 11 11
Genomic Location (Zv9):
Chromosome 13 (position 34870969)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34522021
GRCz11 13 34648027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTTTTTGTGTATTTTATCTAGGAAGATRCAGTGGCTCTCAGAAAAGAG[G/T]GAATCGGTGTAGTGCTTGATTCCCAAATACCCTATTTAATCCGCATTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7731
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Nonsense 624 1309 19 19
ENSDART00000131543 None None 433 None 11
Genomic Location (Zv9):
Chromosome 13 (position 34852859)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34503911
GRCz11 13 34629917
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTATTACAGATKMTTCCCACATCTCATGCTCCAGACATCCTCTTATCT[C/T]AAAACAAGACAGACAGTAGTTTCAGTGGACCTTCMGAGTCTCAGCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35543
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Nonsense 1042 1309 19 19
ENSDART00000131543 None None 433 None 11
Genomic Location (Zv9):
Chromosome 13 (position 34851605)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34502657
GRCz11 13 34628663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCAGTCCCACACACTCTTTAAGTGTTTTCTATGAACTATCCTTTCAG[C/T]AACTACTGGAGATAAACATAGGTTTTGCTGGGCAGTCAGTCAGACTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15751
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113661 Nonsense 1231 1309 19 19
ENSDART00000131543 None None 433 None 11
Genomic Location (Zv9):
Chromosome 13 (position 34851036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34502088
GRCz11 13 34628094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGCCCAGTTCAGACTAATAGACTTTCGGCARCGYTCTGAAGTTCGTTG[T/A]GTGCTGGTCAGAGAGGGATATGRARGCATGTGTCTGGATGYGGTCTTGGC
Associated Phenotype:
Not determined