Busch Lab

ZMP

adh5

Ensembl ID:
ENSDARG00000080010
ZFIN ID:
ZDB-GENE-011003-1
Description:
alcohol dehydrogenase class-3 [Source:RefSeq peptide;Acc:NP_571924]
Human Orthologue:
ADH5
Human Description:
alcohol dehydrogenase 5 (class III), chi polypeptide [Source:HGNC Symbol;Acc:253]
Mouse Orthologue:
Adh5
Mouse Description:
alcohol dehydrogenase 5 (class III), chi polypeptide Gene [Source:MGI Symbol;Acc:MGI:87929]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4573
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108825 Essential Splice Site 87 376 3 9
Genomic Location (Zv9):
Chromosome 14 (position 45841401)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 43186413
GRCz11 14 43598086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAGGCACTGTTGAGAGTGTTGGTGAAGGGGTCACCAAATTCAAACCAG[G/A]CACGTCAAAATAGACTATTTACCCTGACTCGAATAACACAGAGACAGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28359
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108825 Essential Splice Site 117 376 4 9
Genomic Location (Zv9):
Chromosome 14 (position 45841146)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 43186158
GRCz11 14 43597831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGCAAGTTCTGTAAAAATCCAAAAACCAACCTGTGCCAGAAAATCAGG[T/A]AATTATGAATTATTCAATTTATCTTTATTTGTTCAGCACTTTAACAATGT
Associated Phenotype:
Not determined