Busch Lab

ZMP

BAHCC1

Ensembl ID:
ENSDARG00000080009
Description:
BAH domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29279]
Human Orthologue:
BAHCC1
Human Description:
BAH domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29279]
Mouse Orthologue:
Bahcc1
Mouse Description:
BAH domain and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679272]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa24918 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45472 Nonsense Mutation detected in F1 DNA Not yet available
sa45473 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15411 Nonsense Available for shipment Available now
sa35350 Nonsense Available for shipment Available now
sa42078 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42079 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35351 Nonsense Mutation detected in F1 DNA Not yet available
sa874 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24918
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 101 2554 3 37
Genomic Location (Zv9):
Chromosome 12 (position 36705984)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34516441
GRCz11 12 34617504
KASP Assay ID:
554-7446.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTACAAAACTTAGACATGCAAAACTATGTCTAAATTTGATTTCTTTCC[T/C]TAGATTTCTATCTACGAAGCCTCCCATCGCAGCCCCACCTTCTCTCTGCA
Long Flanking Sequence:
GAAGAAATAAAAGTTTCTACATAAACAAACATGTAAAACATACATATTTCTAACAAGGTGTTAAATTATTGTAAACAGAAGTTCTGAAAGCTCTTGTTTAGTTAAGCTACTCATAAATGTCGGGTAAAGAACTGAACTTGTTTGTGCAGGGGTTTCTGGGAAAGGTTGTACCGTGCTTTAGGGCTTCATGAACCTGAGTCCAGCCACAGCAAAAGGCCAAAACTGTCACTCTCTTTTGTTACATTTGTTTATCCTGACAATGTTCTCTCTCCATTCTCTCTCTCTCTCTCTCTCAGCCCCAGGGTATCCCCGCTTTTCAGGGAGTCTAGCCCCCACCTTCCTGCCCATGAGCCCCCTGGATCACCATGGCAACAGCAGCGTACTTTATGGACAGCACCGTTTCTATGACACTCAGAAAGGTGAGTGAGGTTCAGTTTCTTTTGTCAAGCAGCCTACAAAACTTAGACATGCAAAACTATGTCTAAATTTGATTTCTTTCC[T/C]TAGATTTCTATCTACGAAGCCTCCCATCGCAGCCCCACCTTCTCTCTGCAAATCACAGCCTCCCACCGCTTTCTAGAACTGCTCCTGCCCACCCGCTGGACTCCTGCAGTCGTGAGAGGGAACCTGGAAGCACAGTTTCCCAGAAGAGCTCCAAAGAGACAGGTGTAGCGGAGCGAAGAGTAGGACCCGGAGGAAAAGAAAAAGAAAAGAGTAAACAAGAATCTAAGCAGGATCGTCATCATGGTCCTCCCACCCTTCATCACCACCACCAGCATCATCCACAGCATCATCCCCAAGGCCTAGAAGATGACTTTCGGCACAAAGATGACCCCAAGCACCTTAGCTCCTGCCTGCTTAGCACTAAGACGCAGAATGGCTCTGATCCAGGGGCGGCCACCAGGGGCTCTTTACCCAGTTGTGTGGGTCCTGGAGCCTCCAGTCTGGGGACTGGCCGGCAGACAAGTGGAGACAGTCACTGTTGCAAGGAAGGGGTCAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45472
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 224 2554 3 37
Genomic Location (Zv9):
Chromosome 12 (position 36706353)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34516072
GRCz11 12 34617135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGATGACCCCAAGCACCTTAGCTCCTGCCTGCTTAGCACTAAGACG[C/T]AGAATGGCTCTGATCCAGGGGCGGCCACCAGGGGCTCTTTACCCAGTTGT
Long Flanking Sequence:
CAACAGCAGCGTACTTTATGGACAGCACCGTTTCTATGACACTCAGAAAGGTGAGTGAGGTTCAGTTTCTTTTGTCAAGCAGCCTACAAAACTTAGACATGCAAAACTATGTCTAAATTTGATTTCTTTCCTTAGATTTCTATCTACGAAGCCTCCCATCGCAGCCCCACCTTCTCTCTGCAAATCACAGCCTCCCACCGCTTTCTAGAACTGCTCCTGCCCACCCGCTGGACTCCTGCAGTCGTGAGAGGGAACCTGGAAGCACAGTTTCCCAGAAGAGCTCCAAAGAGACAGGTGTAGCGGAGCGAAGAGTAGGACCCGGAGGAAAAGAAAAAGAAAAGAGTAAACAAGAATCTAAGCAGGATCGTCATCATGGTCCTCCCACCCTTCATCACCACCACCAGCATCATCCACAGCATCATCCCCAAGGCCTAGAAGATGACTTTCGGCACAAAGATGACCCCAAGCACCTTAGCTCCTGCCTGCTTAGCACTAAGACG[C/T]AGAATGGCTCTGATCCAGGGGCGGCCACCAGGGGCTCTTTACCCAGTTGTGTGGGTCCTGGAGCCTCCAGTCTGGGGACTGGCCGGCAGACAAGTGGAGACAGTCACTGTTGCAAGGAAGGGGTCAGTGGAGAAATGCGAATTAGCGAGCCAGCCTCAGACTGCCTTCGTCACAGTGCCATGCTGGGCCATGCCCACCCAATGCCCTACTCCATGCCCCCACCTCTGGGCCTAGGCTCTGCAGTGGGAGGATCCTGGCTGCATCCGAATCATCCACACCATCACCATCCTCATCATCCCCATGCAGAGCTCTTTTGTCCACCTCCCCCTGCTCCACTGACCATGCCCACTGCTCAGGAAAAGAGCCTTGGCAGAGACTCTGAGGTTACAGGGCCCACCTTTGTGCCCTCTGTGGGGCCACTGGGAGATAAAATCAGTGGACCATTCCAGCTGGGGAACCATCACTGTCGAGGTGTGGGAGGTGGTATGATTGCAGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45473
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 425 2554 5 37
Genomic Location (Zv9):
Chromosome 12 (position 36707060)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34515365
GRCz11 12 34616428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTACGCACAAACGAGGTTCAGCACAGTCAGAATCAGCATACCCACTC[A/G]GCACGTTCATGTAGCTTGGACAGCAGTGAGGAATCTGATGCCTTTCGTCC
Long Flanking Sequence:
TACTCCATGCCCCCACCTCTGGGCCTAGGCTCTGCAGTGGGAGGATCCTGGCTGCATCCGAATCATCCACACCATCACCATCCTCATCATCCCCATGCAGAGCTCTTTTGTCCACCTCCCCCTGCTCCACTGACCATGCCCACTGCTCAGGAAAAGAGCCTTGGCAGAGACTCTGAGGTTACAGGGCCCACCTTTGTGCCCTCTGTGGGGCCACTGGGAGATAAAATCAGTGGACCATTCCAGCTGGGGAACCATCACTGTCGAGGTGTGGGAGGTGGTATGATTGCAGTTGGTGGCAGTGCAGGGAAAGAAACGAAAACTCCTGAGAGGAGTAGCAGTGGAAGTCGAGCAGCTAACCTACTGCCTCAGAATAGCTGCCAAAGAAAATCTTCCCAGCAGCAACATGCATATGGTAAAGCAGACAAGAGTCCAGACTGGCCCCCCGGCCCCCATTTACGCACAAACGAGGTTCAGCACAGTCAGAATCAGCATACCCACTC[A/G]GCACGTTCATGTAGCTTGGACAGCAGTGAGGAATCTGATGCCTTTCGTCCCTCTCTGCCACAGGGGACGAAGGGTGGCCACCAAGCTAAGAGTAGCATTTATGCCAGCACTCCACCTTTCCGGGACTGTTCTCACTCAGGTCCGTCAAACAGGGCATCGTCCGAAGGTAAAGGAGCCACGGAGGTTGAGTGTACTCAGAAAAGCAGCCAGAGGGTTGCACGAATACGTCATCAGCAGCACAGGGCTAGCACTGGTGGACAGGGTCCAGAGATGGAGCCTAACAGTACCACACAAGACAAGAGGAAAATGGACATGGAGTCAGCATCACAAGGATACGGCGGGAATCGGACCGGAACTCATCCCTCCTGGGAAGTGCGAGGACCCCAGCCTCGGCCAGATGAAGAACCACACAAGGCTTACAACTCTTTGGGTGCTGCTTCCCAGACTTCACGTGTGGACCAAGGGCCTCTTCCCCCTCTAACAGCCCCGCAGGAGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 498 2554 5 37
Genomic Location (Zv9):
Chromosome 12 (position 36707280)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34515145
GRCz11 12 34616208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGAGCCACRGAGGTTGAGTGTACTCAGAAAAGCAGCCAGAGGGTTGCA[C/T]GAATACGTCATCAGCAGCACAGGGCTAGCACTGGTGGACAGGGTCCAGAG
Long Flanking Sequence:
ATAAAATCAGTGGACCATTCCAGCTGGGGAACCATCACTGTCGAGGTGTGGGAGGTGGTATGATTGCAGTTGGTGGCAGTGCAGGGAAAGAAACGAAAACTCCTGAGAGGAGTAGCAGTGGAAGTCGAGCAGCTAACCTACTGCCTCAGAATAGCTGCCAAAGAAAATCTTCCCAGCAGCAACATGCATATGGTAAAGCAGACAAGAGTCCAGACTGGCCCCCCGGCCCCCATTTACGCACAAACGAGGTTCAGCACAGTCAGAATCAGCATACCCACTCAGCACGTTCATGTAGCTTGGACAGCAGTGAGGAATCTGATGCCTTTCGTCCCTCTCTGCCACAGGGGACGAAGGGTGGCCACCAAGCTAAGAGTAGCATTTATGCCAGCACTCCACCTTTCCGGGACTGTTCTCACTCAGGTCCGTCAAACAGGGCATCGTCCGAAGGTAAAGGAGCCACGGAGGTTGAGTGTACTCAGAAAAGCAGCCAGAGGGTTGCA[C/T]GAATACGTCATCAGCAGCACAGGGCTAGCACTGGTGGACAGGGTCCAGAGATGGAGCCTAACAGTACCACACAAGACAAGAGGAAAATGGACATGGAGTCAGCATCACAAGGATACGGCGGGAATCGGACCGGAACTCATCCCTCCTGGGAAGTGCGAGGACCCCAGCCTCGGCCAGATGAAGAACCACACAAGGCTTACAACTCTTTGGGTGCTGCTTCCCAGACTTCACGTGTGGACCAAGGGCCTCTTCCCCCTCTAACAGCCCCGCAGGAGGCCACACTGGGCCCTCAGGGACCTGAAAGCAATGCCATGAGGAATCTGATGAAGTACAGTAGCCAGCAACCACTGCTGTTCACTCAGAAGAGCCCATTTGGTGGTCTGGGCTGCCTCAAGCAGGGAGCAGTAGCTGGGGAGAGAAGTGAGAGGAACGAAAGAAGCGACAAAAGTGGAAATGGTTCGAGCTGTGCTCTCCAGGAGGGAAAGCAGACCCTGCCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35350
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 890 2554 10 37
Genomic Location (Zv9):
Chromosome 12 (position 36713440)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34508985
GRCz11 12 34610048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTACGGAGCCCGAGGGCCCACCTCACACATGCAGCATCCCGCAGTCTA[T/A]TCCCGCTCCCAGTTTCTACGGCAACAGGAACTCTACGCGCTGCAGCAACA
Long Flanking Sequence:
TCTTGACTGGCACTGCGGCTTTCATGAGCCAGAGATCAGGCTAGTGTAGCTGGTGAGCTCACTGGTGACCATCGTTTTGCGTTAATCCACTGAGGTATGGCCAGACGAGCTGTGAGTGCATGGGGCAGACGATGATAAAAGGAAGTTTGCATTCACTCTCTGCCCACGGGTTGAGTGCACAACATGATGAGGAAAGAGATGTGGAAATGTGAGGGTTTTTTACCCTTGGGACTGAGGATGACTTTTGCAAAGAAAAAAGAGAGTGAAAAAAGAGGGACGGAAAAGGGGTGGAATCTTATAGCCGTAAATCAATAGGCCTTCAGAGCGATAAGTGAGACTTGCCTTGAGGCGAAAGAAAAACCTTTGTTCATACTTTTCTCATTCCTGTATCTTTCTCTCTCTCGCTTTCTCTCTGTAGATGTAATGGAGCAGCAGGGACTGTGGCCCCCTGTTTACGGAGCCCGAGGGCCCACCTCACACATGCAGCATCCCGCAGTCTA[T/A]TCCCGCTCCCAGTTTCTACGGCAACAGGAACTCTACGCGCTGCAGCAACATCAGCACCAGCAGCACCGTGCAGCACAGGCTATGGAGTTGGCGCACAGACACAGTCACTCACAGGTAACACATGGAGGAGGATTTGTACACACGGTTAGCCCTGCTTCCTCATACACCTCAAGGTGATTTCCCAGCAGCTATTTCTCTGCGTCTTTCAGCAGACCTACCCAGGACGCCCGAGGTTGCGAAAGGCCTGTTATTCCTGCTCTCAGAAATTCATAGCAGTTTTAGCCAAAAGAATGGCCAGCTTTCATTTTCAAAGTGCATTTTAATGTTGGACATTTTGAAAGAGTGGGATTCTTCTCAGGAACGGGGCCGGTTTCTGCTTTTATCTGACTTCTTTTGTACAAAGAAGCAGAGCAGAATGCAAGTGAACAGTGGATCATTAGCACCCATTGTACTGCATCCCTGGTGGATGTCCTTACGTAAGAAACCTGAGACGACTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42078
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 1577 2554 23 37
Genomic Location (Zv9):
Chromosome 12 (position 36745516)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34476909
GRCz11 12 34577972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAGTCCAGTCAAGATGTCAATGCATTCAATCGATCCATCATTTTCACA[G/T]AGGAGGAAGATGACGGCATCTACGACAGCGAGGAAGGGGCAGAGGGCATC
Long Flanking Sequence:
GCTGTGCATGTGTTGTTCATGATTAGTTCATGTTAGTAAATGCATTAACTAATGAACCTTATTGTAAAGTGTTACCGGCACTTCTATGTTAAGCTGTTTTGAGACAATCTACATTGTAAAAGCGCTATAGAAATATACATGAAATTAATTTAATTGAATGAATTTTATAATGTGTATTTTAAAGAGCAGTGTTGGTGCGGTCTCAGATTTGTAATGGTAATGTATTTGCAGCTGAATCAGGAGCTTGAATCAGTCACTAGGTCTGACACTTGATGGTCAAACCTGCCAGTGACTAGACTTCTCTGACTGCTAAAGTTCCTGTGAACGCTGACAGTCACAGCCACATTTGGCACCCGTTTCATGAACTTTGCTAAATATCGAACAAACCGCGCAGTGAGAGAAATCGGCAGGCTGCGTTCGCCATGACCGATTCAGACGCCTGCTGTGAACTGTAGTCCAGTCAAGATGTCAATGCATTCAATCGATCCATCATTTTCACA[G/T]AGGAGGAAGATGACGGCATCTACGACAGCGAGGAAGGGGCAGAGGGCATCAAGAATCTATCATCTAAAGAGCAGCTGTCTGGAGCCGGCCGTCCTTCACAGTGCTCCATCGTGAAGCTTGAGGCTAATCAGAAAGCCAAGAACAAAACTGAAAGACAAGGATTCGGTAAATGTTACATCTTTGCTTAATTAGACAGCATGGATTGACAGATATCACCTTAGTTCACAAACACTCATCTTTCACTGTCATTCTTACCATTTTTTTTTCTGATTCCCTCCAGGGTCTATGAATGTGTCCGTCACTAAAGAAGAGATGAAGAGAAGGAAGGCCCCCTGTAGGCCAGCCCAGGTCTGTGCTGACCATAACCACTCAGAACTAGATGAGGACAGGAGATTGACTGGCCCGAAGTGGAGAGAGGGCTCAAGGGAGAACACCTTTGACCACACTAGGGTTCTCAAAACCTCACCTACTCCACGAGAAAGGACCACCAGGAAGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 1851 2554 29 37
Genomic Location (Zv9):
Chromosome 12 (position 36749397)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34473028
GRCz11 12 34574091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGTTACTGTATGCTGCTTATGTACATACATTGGACCTGCCTGATATG[T/A]AAGAGAACCAGACCTGCATTATGGATGGATGGATGTATAAGTAGCTGGAT
Long Flanking Sequence:
GTGTGTGTGTGTGCGTGTGCGTGTGCGTGTGTGTGTGCGTGCGTGTTTGTGTGCGTGTTTGTGTGTGTGTGTGGAAGAATGAGACTCACATGCTGTTTCGTGACTGTTAGCAGGCAAAGGGACGAGCAGTCAGTCGTTTGCTGGAGAGCTTTGCTGCCGATGAAGGTTTCCAGATAGACGATGACAGCAGCTTCTCAGAGGGAGAGGAAGAAGAGGAGGAGGAAGAGGAGGAACCAGAGCTGATGGGCAGTGCTTTGCCAGGTACAAAATATGCAAACAGACTGGCATGATTGAAATGTAACTGTGTTCATATCAACATAGAATGTGCTCGTGGTCAAAAGAGAATGACCTCTACCTTTAATCTGTCTTTGTCTCAACCAGCCCTGCCCAACTGCATTCTCACCAAAGAAATCCTGAGGGATGGGCTGAAAGTATTGATCTCGAAAGAGGACGAGTTACTGTATGCTGCTTATGTACATACATTGGACCTGCCTGATATG[T/A]AAGAGAACCAGACCTGCATTATGGATGGATGGATGTATAAGTAGCTGGATGAATTGGTGGATGGATGGATGGATGGATGAATGGATGGATGGATGGATAAGTGGATGGATGGATGGATGGATAAGTGGATGGATGGATGGATAGATGGATGGGTTGTTGGGTAGGTGGATGGATAGAAAGGTTAATAGAATGAATGACATAATAGATAGATAGAACAATGAAATGACGTATGGATGGATGGATGGATGGATGGATGGATGGATGGATAAGTGGATGGATGGATGGATGGATGGATGAATGGATGGATGGATGGATGGATGGATAAGTAGATTGGTGGATGGATGGATGGATGGATGGGTGGGTGGGTGTGTAGGTGGAGGGATAGAAAGATGAATAGAAAGAATGACATAATAGATAGAACAATTAAATGATGGATGGAGAAGTAGATGGATGGATGGATGGATGGATGGATGGATGAATGGAAAAATGAATGGAATGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4477
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Essential Splice Site 2002 2554 33 37
Genomic Location (Zv9):
Chromosome 12 (position 36755466)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34466959
GRCz11 12 34568022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTCTAACACAGAGCCAAGGAAGAGTGCCRTTAAAGCCAAGCCAGGTG[C/T]GAGATGACAGCTGCATTATCCATATTCTCACGGTTTCCCAAACTGATTCA
Long Flanking Sequence:
GCGCACGAAAAACCAAGTTATAAATTAGTTACAAAAAATAAACAATAAAGTTCATTTTTACATATGTGTACATATGTGTTGTTTAGAGCTCTACTTTTATATATTCCTCAGGAGGTCCAGGTGAGGAACAGAAGGAGGGAAGTGTCATGGTGGAGTTTGACGATGGAGACCGGGGATGGATTTCCCTTTCAAGTATTAGGTGTCTTCCGCCAGGCTACCAAGTCCACTGTAGGTTTCTGCAGATAAACGACTTTCATCTCCAACATAAACATAGAATCTCGTGTTTAGACATTGTGCAAAGGTTCCATATTTAAAATTAAGCCTGTGGTATTATTGATGTACTGCAGGTGCAGAGCCATCACCAGCCCACCTGATCTCACCTAGCTGCCGCAGGAGGAAGACCTCCACCCAAGAGAAGATAACTCAGCAGGCTGATGCATCCAACGAACGTTCCTCTAACACAGAGCCAAGGAAGAGTGCCGTTAAAGCCAAGCCAGGTG[C/T]GAGATGACAGCTGCATTATCCATATTCTCACGGTTTCCCAAACTGATTCAATTAAATTAATTTTGGTTACTGGTTGCACAGTGTAAACAGATGCTTTTCACATAATCTAAGATTAAAATCTGTCACAGTTTGCATACATCCCTTAGGTGCTACTTTTAACCTATAACGAGAAAGGTAAAACATGTTGTTTCAAAGAGGCACGTTGAGAAACATCTATCAAACAGGATTCCACAACAGGCCTTTGTGATTTAGTGATTTACTCACTAATCACAAGGTTTGTCAGGGGAACTTGCTGGGTGATGTTTCTCAGTTTGTTTGTCCCTAAGGACACGCTTCACTACTTTTCCCGGTTCTTGTTCCTGGAACTGACGCACCCACCAAATGATTTATTTGCTGTTTGTCAAGAGCCCTAAAAGTCTTATCAGATCTAAGGTAAAATAATCTGGCTTATTAATCTGCAATAAATGCGGAAGAAAGAGGCATTTTCCCTCATTACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35351
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 2165 2554 34 37
Genomic Location (Zv9):
Chromosome 12 (position 36756795)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34465630
GRCz11 12 34566693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAGACTAAAAATGGAAAAGCATTGTTGCTTCTTGGGAACCCAGAGCTA[C/T]AAAGAAGTGGACGAATGGAAAAGGGCTTTGGAGCCAAAGGTATTGGAGAG
Long Flanking Sequence:
CTGAGTCCCCTTAGCAATACCTTTGTTTATCTCCATCAACAGGAAGGCCAAAATCTGTCAATGCATCATCAAAGAGCGGTGCATCTGAGAATGTGACCGAAACTGCTTCCCCTCTTCTCAGCTGGCCAGTTGCCACCATGTCCAGGAGGAAACCCTCCATGGATTTGTTCCAGTTTAATGGGTTAACAAAGAAAGCTCTTAAGGGAAAGGAGTCAGACATGTTCCCCCTACTTAGCTCCACTATGACCACTCCAGCCAAAGGCATCTTCAGCACTTCCTTTGAGGTGGACTCTTTCAGCAGCATTGCAAATGGTTGCACTTCCTTTGGAAATCAACAGTTGGCACCAGGCCTGCCTCCTAGTCACAAGGTTGTCCCTGGGTCACGGTGTAGAAAGATAGGAGACAGGAAGGAATTTCTGGTCAAACTGGACCATGAAGGGGTAACATCCCCTAAGACTAAAAATGGAAAAGCATTGTTGCTTCTTGGGAACCCAGAGCTA[C/T]AAAGAAGTGGACGAATGGAAAAGGGCTTTGGAGCCAAAGGTATTGGAGAGCTGACCTCAACAATGGGCTATTCCCAGTCTGTTCTTCTTGTCAAAGATGCCAAAAGGAACAGTTGCCATCTTCTCAAAGGTTCCTCTGACATGCGAAAGCACCCTCAGGGTCTCGGGCTTAGTGAATATACAGATTATGGGCCAAATTGCCACAGCGACTGCCTAAGCTCTTATTCAGACATGGATGAAGATGAAGATGAGGAGGAAGATGCCAGAAGGGCGGCAATGCGCACCACTGGACGTTTTTTGTCTCGTCTTTCTGTTTCATCGTCATCCTCAGGATCCTCCAGTGCATCTAGCTCAGGCTCATTGTCCAGTTCCAGCGTCTGCTCGTCTGACAATGATTCGTCCTACAGTTCAGATGAAGAAGAGGCATCTCGGCTTCTGCTCCAGGGTTGCCTTTCTTCTCATCACACATTGCTCCAACAACAGCAGCATTCAGACCCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa874
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110615 Nonsense 2188 2554 34 37
Genomic Location (Zv9):
Chromosome 12 (position 36756866)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34465559
GRCz11 12 34566622
KASP Assay ID:
554-0776.1 (used for ordering genotyping assays)
KASP Sequence:
AAGGGCTTTGGAGCCAAAGGTATTGGAGAGCTGACCTCAACAATGGGCTA[T/A]TCCCAGTCTGTTCTTCTTGTCAAAGATGCCAAAAGGAACAGTTGCCATCT
Long Flanking Sequence:
AAGAGCGGTGCATCTGAGAATGTGACCGAAACTGCTTCCCCTCTTCTCAGCTGGCCAGTTGCCACCATGTCCAGGAGGAAACCCTCCATGGATTTGTTCCAGTTTAATGGGTTAACAAAGAAAGCTCTTAAGGGAAAGGAGTCAGACATGTTCCCCCTACTTAGCTCCACTATGACCACTCCAGCCAAAGGCATCTTCAGCACTTCCTTTGAGGTGGACTCTTTCAGCAGCATTGCAAATGGTTGCACTTCCTTTGGAAATCAACAGTTGGCACCAGGCCTGCCTCCTAGTCACAAGGTTGTCCCTGGGTCACGGTGTAGAAAGATAGGAGACAGGAAGGAATTTCTGGTCAAACTGGACCATGAAGGGGTAACATCCCCTAAGACTAAAAATGGAAAAGCATTGTTGCTTCTTGGGAACCCAGAGCTACAAAGAAGTGGACGAATGGAAAAGGGCTTTGGAGCCAAAGGTATTGGAGAGCTGACCTCAACAATGGGCTA[T/A]TCCCAGTCTGTTCTTCTTGTCAAAGATGCCAAAAGGAACAGTTGCCATCTTCTCAAAGGTTCCTCTGACATGCGAAAGCACCCTCAGGGTCTCGGGCTTAGTGAATATACAGATTATGGGCCAAATTGCCACAGCGACTGCCTAAGCTCTTATTCAGACATGGATGAAGATGAAGATGAGGAGGAAGATGCCAGAAGGGCGGCAATGCGCACCACTGGACGTTTTTTGTCTCGTCTTTCTGTTTCATCGTCATCCTCAGGATCCTCCAGTGCATCTAGCTCAGGCTCATTGTCCAGTTCCAGCGTCTGCTCGTCTGACAATGATTCGTCCTACAGTTCAGATGAAGAAGAGGCATCTCGGCTTCTGCTCCAGGGTTGCCTTTCTTCTCATCACACATTGCTCCAACAACAGCAGCATTCAGACCCTCCCACCGCCCCACCACGACACACTTTTGGAGCCAAAACTATGAGTATCTCTAATTCAAAGGCTGCAGTAAATAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461