Busch Lab

ZMP

LOC559077

Ensembl ID:
ENSDARG00000079992
Human Orthologue:
SENP6
Human Description:
SUMO1/sentrin specific peptidase 6 [Source:HGNC Symbol;Acc:20944]
Mouse Orthologue:
Senp6
Mouse Description:
SUMO/sentrin specific peptidase 6 Gene [Source:MGI Symbol;Acc:MGI:1922075]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42977 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23133 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7836
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112257 Essential Splice Site 74 565 3 16
Genomic Location (Zv9):
Chromosome 17 (position 37026920)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36911817
GRCz11 17 36859402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTTTTATTTACAGTTTACAGTGGATTGCATTGAGATCAGTTCTGAAGG[T/A]AAGCCARACATTAAGGTTTTWAATAATTCWGATGTTTTATTGATKAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42977
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112257 Essential Splice Site 284 565 8 16
Genomic Location (Zv9):
Chromosome 17 (position 37022919)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36907816
GRCz11 17 36855401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATGAAGGGGAATTTTTAAACGATGTGATAGTAGATTTCTATCTAAGG[T/G]TAGATTTGTAGAAGTGGCTATATATTTTAGTCTGTTGTTTCTGTAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23133
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112257 Nonsense 541 565 16 16
Genomic Location (Zv9):
Chromosome 17 (position 37017869)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36902766
GRCz11 17 36850351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAGGACCCACCTCAAGCTTTTCATCACAACATGGACTTGAAAGGCTG[G/A]TTTTCACAAAGAACAGTAAAAAGGAAGAGGTTGCAAATCAAAGAGCTCAT
Associated Phenotype:
Not determined