Busch Lab

ZMP

ACVR2A (2 of 2)

Ensembl ID:
ENSDARG00000079944
Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Human Orthologue:
ACVR2A
Human Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Mouse Orthologue:
Acvr2a
Mouse Description:
activin receptor IIA Gene [Source:MGI Symbol;Acc:MGI:102806]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18285 Nonsense Available for shipment Available now
sa33786 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18285
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Nonsense 67 514 2 13
Genomic Location (Zv9):
Chromosome 6 (position 1460109)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 870506
GRCz11 6 1724875
KASP Assay ID:
2259-6979.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAGAAAAGGACAAGCGRCGACACTGTTTCTCCACCTGGAAGAACCGCT[C/A]GGGRACCATCGAGATGGTSAAGCAGGGCTGCTGGCYGGACGATGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33786
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Essential Splice Site 272 514 8 13
Genomic Location (Zv9):
Chromosome 6 (position 1450278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 880337
GRCz11 6 1734706
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGGAGTTGACATAGAGCTGTGGCTGATCACAACCTACCATGAGAAGG[T/C]ACACACACAGATATAAACACACATGCACAAACACACAAACATAGATACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025989 Nonsense 352 514 10 13
Genomic Location (Zv9):
Chromosome 6 (position 1449257)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 881358
GRCz11 6 1735727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCCTGCATCGCTGACTTTGGCCTGGCGCTCAAGTTTGAAGCAGGAAAAK[C/A]AACAGGTGACACACACGGACAGGTAAATACCACATTTACATCTGCAGAAA
Associated Phenotype:
Not determined