Busch Lab

ZMP

jmjd1c

Ensembl ID:
ENSDARG00000079939
Human Orthologue:
JMJD1C
Human Description:
jumonji domain containing 1C [Source:HGNC Symbol;Acc:12313]
Mouse Orthologue:
Jmjd1c
Mouse Description:
jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa18109 Nonsense Available for shipment Available now
sa15925 Nonsense Available for shipment Available now
sa11812 Nonsense Available for shipment Available now
sa22034 Nonsense Available for shipment Available now
sa6235 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18109
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1110 2557 11 27
Genomic Location (Zv9):
Chromosome 12 (position 9378589)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8586544
GRCz11 12 8624387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCCAAAAGCCACGAGAAAGAGACAGAGMACTCTATGGCTGATCTGTA[C/A]AAGTACAAAMAYTCWGTATCTCAGTCTCTCCCTCAAACCAACTACTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15925
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1560 2557 11 27
Genomic Location (Zv9):
Chromosome 12 (position 9377241)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8585196
GRCz11 12 8623039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTMCACGCCCAGCAATCCWCYCAGCAAAGCCAGCCCGTTGCCCAATGGA[C/T]AGGCAGCGCAGGTGTGCCAGTCTAACYACCACAAACTCAAGAAAGCCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4452
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1560 2557 11 27
Genomic Location (Zv9):
Chromosome 12 (position 9377241)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8585196
GRCz11 12 8623039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTMCACGCCCAGCAATCCWCYCAGCAAAGCCAGCCCGTTGCCCAATGGA[C/T]AGGCAGCGCAGGTGTGCCAGTCTAACYACCACAAACTCAAGAAAGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11812
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1677 2557 11 27
Genomic Location (Zv9):
Chromosome 12 (position 9376890)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8584845
GRCz11 12 8622688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGGAGCAAAGGACTAARCGGCAACCCAAGCCCACTTACAAAAARAAG[C/T]AGAACGACATGCAGAAAAGGAAGGGAGACAATGAGAAGGAGGAGGACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22034
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 1911 2557 15 27
Genomic Location (Zv9):
Chromosome 12 (position 9366316)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8574271
GRCz11 12 8612114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTAATCCACCTTTTCTTATTCCGCAGATAAAGAGCTGTACGCCTG[G/A]TTGAAGTGTGTCAAGGGACAGCCTCATGATCACAAGCACCTGATGCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6235
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113148 Nonsense 2222 2557 20 27
Genomic Location (Zv9):
Chromosome 12 (position 9349641)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8557596
GRCz11 12 8595439
KASP Assay ID:
554-4711.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGTAGCCTGTACTAGTCTCTGGGGTGCACCGAAGGCTCAACGCCAGCT[T/A]GTGGAAAGCAGAGTCCTTCAACCAAGAGTTTGCTGACCACCAGGGGGACC
Associated Phenotype:
Not determined