Busch Lab

ZMP

stoml3

Ensembl ID:
ENSDARG00000079914
ZFIN ID:
ZDB-GENE-070620-18
Description:
stomatin-like protein 3 [Source:RefSeq peptide;Acc:NP_001092220]
Human Orthologue:
STOML3
Human Description:
stomatin (EPB72)-like 3 [Source:HGNC Symbol;Acc:19420]
Mouse Orthologue:
Stoml3
Mouse Description:
stomatin (Epb7.2)-like 3 Gene [Source:MGI Symbol;Acc:MGI:2388072]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8597 Nonsense Mutation detected in F1 DNA Not yet available
sa35790 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8597
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131173 Nonsense 61 313 2 7
Genomic Location (Zv9):
Chromosome 15 (position 3358910)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3262168
GRCz11 15 3249684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTATGTTTTTTAGATGATAAACCGCCCTCARTGGGATGCTTTGGCTG[G/A]TTAATTATCATCATCGCCATTATTATCACCATTGGTTTACTTCCCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35790
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131173 Nonsense 196 313 5 7
Genomic Location (Zv9):
Chromosome 15 (position 3357732)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3260990
GRCz11 15 3248506
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGAGAAATGTGCTCGGAACAAAGAACCTGTCCGAGCTACTGTCTGAC[A/T]GAGAGGGCATCTCAAACAGCATGCAGGTACAGGCAACTCCATCCTTTCCA
Associated Phenotype:
Not determined