Busch Lab

ZMP

si:dkey-175m17.8

Ensembl ID:
ENSDARG00000079905
ZFIN ID:
ZDB-GENE-030131-4145
Human Orthologue:
MARK2
Human Description:
MAP/microtubule affinity-regulating kinase 2 [Source:HGNC Symbol;Acc:3332]
Mouse Orthologue:
Mark2
Mouse Description:
MAP/microtubule affinity-regulating kinase 2 Gene [Source:MGI Symbol;Acc:MGI:99638]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1844 Essential Splice Site Available for shipment Available now
sa23953 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1844
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040754 Essential Splice Site 247 768 8 19
ENSDART00000137667 None None 109 None 6
ENSDART00000138266 None None 243 None 6
ENSDART00000143239 Essential Splice Site 247 736 8 18
ENSDART00000146959 None None 139 None 3
ENSDART00000147589 None None 140 None 7

The following transcripts of ENSDARG00000079905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26623051)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27191962
GRCz11 21 27228657
KASP Assay ID:
554-1835.1 (used for ordering genotyping assays)
KASP Sequence:
GTACACACTGGTCAGTGGTTCTTTGCCGTTCGATGGACAGAACCTAAAGG[T/C]GAGCATTGCGAAATGAGAGTAATTGTYAGTATKTTTACAWTTTTATATTG
Long Flanking Sequence:
GGATTTCAGTACACAACCTTGCTTGCTTGAGCTATTTGTTTTAGAAGTCCGCTTGTGTGCAATAATCCTTTATTTGTCTGTGCTTGTGTGTTCAGATTGTATCAGCGGTGCAGTACTGTCACCAGAAGTGCATTGTTCACAGAGACCTCAAGGTACATATGATATATTTTCCAGCTTTTGAGAGTTTAATCTTCTGTGCTCATGCAGTTATTTAATTTCACCCCTAAATACATAATAGCTAAAAATCCTCTCTCGCTCTCAGGCAGAGAACCTGCTTCTGGATGCAGACATGAACATCAAAATTGCAGACTTTGGCTTCAGTAATGAGTTCACACTGGGCAACAAGCTGGATACTTTTTGTGGCAGTCCTCCTTATGCTGCCCCCGAGCTCTTTCAGGGGAAAAAGTACGACGGGCCGGAGGTAGATGTCTGGAGCCTTGGGGTCATACTGTACACACTGGTCAGTGGTTCTTTGCCGTTCGATGGACAGAACCTAAAGG[T/C]GAGCATTGCGAAATGAGAGTAATTGTCAGTATTTTTACAATTTTATATTGATTAATTTTGACGTGGACATCACAATTACACTGGAGAACCAAATGCATTTGTTTAAGTGTTTTTGCACCTGTCCACGGGAAGCTTGAAATAAAATAAAAATAAAATAGATACATATACACAACATTATAATTCTTTACATAAAATTGCTGTAAGGGAAACATTTTTAAGAGCACTACTAAAAACTTTTATATAACTTTCTAATGTTAGGCTAACAGGTAAATCATTCCACAATTTGGTACAGATTGAGCAAAAGAGGTCTTACAGTTTGGTACAAGACTGTCACCATTAGCAGTTGCTTGTGTGACTCTGAGAGGTTTGATGCCTACAGATTAATTTAGAAAACAGCATGATTTAAACATTTAACAATTTAAGATTATTAATTTTAATAAAACTAATTTAATCAGAACTTAAAACCTCACAATGATGCTATTGCATAGGCTTTAAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23953
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040754 Essential Splice Site 321 768 None 19
ENSDART00000137667 None None 109 None 6
ENSDART00000138266 None None 243 None 6
ENSDART00000143239 None 322 736 10 18
ENSDART00000146959 None None 139 None 3
ENSDART00000147589 None None 140 None 7

The following transcripts of ENSDARG00000079905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26619213)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27188124
GRCz11 21 27224819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTACATCGAACCCCAGCCTGACTACAAGGACCCTAAGAGGACAGG[T/C]CAGCACCCCAGCAGTGCAGGGGGTTGGAAGAGAGGTGGGGCAGACGCGGC
Long Flanking Sequence:
CAAACTATTGCAGATCTAGTGTTTAATTCTTCCTGTGCAGCTACCTGGTAAACACAATTGACAGATTTGAACATTGATTCCTGGAAATTACATAAAAGCCAGCCGATCAGATCTGGTGGGTTTAGGCAGCTTTTGCTATTTTTGTGTTCAATATGCATCAGACTGTTCATAGGCAATCTGTGGGCGTACAGTCTACAGCTTAGACTCTGCACGAGCAACTGTTTGCAGATTGGTGTGTTTTCTGATTGAGTGATTCAGCTTTTCGCCATTGTTTTTGTTGTTGTTGAATAAGTCTTGATTATATGTGCTTTTCTTTGATAACCTACTAGCAGCACACTACTTGTTACCTCATCTGACCCCTATTGCTTTGTACCTTTTCTCCTTGCTTCTACTCAGCAGCAAATCATGAAGGACCGGTGGATGAATGTGGGCCACGAGGACGAGGAGTTGAAGCCCTACATCGAACCCCAGCCTGACTACAAGGACCCTAAGAGGACAGG[T/C]CAGCACCCCAGCAGTGCAGGGGGTTGGAAGAGAGGTGGGGCAGACGCGGCCCGGGGCTTTGGTGATGGTGGTGGGTGGGGTCTAAGACAGAGATTGGTTTTGATTGGGTAATAAATCATGGTGATGGGACAGGATCTGAATTAATCCAGAATTCATCTGAATTCATTTTTTTTATTTTGTGAGTTATAAATACCTTTCCTGCTTTCTAACAAATCTCTTGTTTCTTTTCTCTCTGTCTTGTGTCTGTGAGAGGTTTGTGCATGATTAAAGTTTCCTTTTATTTTGGTTGTAGCTACTTTCAAAATGATTATATTTAGTTGTATTACATATACTTGCGATTAGGGATGATAATCTCTAACCCGAAGTAATAAAATTTGGTGTGTTATTCATATTACAGTATTTGCAGTGCAGATATGAATGATGCACTAAATTAAATTACATTTTTAAGCAAGCAGAGCTTTTTACTGCTGGATAGCTTTTAAGGATATATTTAGGATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3134
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040754 Nonsense 614 768 18 19
ENSDART00000137667 None None 109 None 6
ENSDART00000138266 None None 243 None 6
ENSDART00000143239 Nonsense 582 736 17 18
ENSDART00000146959 Nonsense 30 139 2 3
ENSDART00000147589 None None 140 6 7

The following transcripts of ENSDARG00000079905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26602508)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27171419
GRCz11 21 27208114
KASP Assay ID:
554-3424.1 (used for ordering genotyping assays)
KASP Sequence:
TAACTTGAATTGAGGGACTAAACTTGTTGGTTTTCTTTGAGGAGTCCGTA[T/A]GAGGGAGAGGGTCGAGATGAGGCCAGCAGGTGAGGACAACAACTAATAAA
Long Flanking Sequence:
TGCCTGCAACAGAAGCACTTTTTTTGCTTCATCTTTGACAGACAAGATTTTAATTTTAGCAAATAGGAATAAGGACAGTTGGTAGTCTTGATTTAGATACTATACAGTATGACAAGTTTTTATTAAGTTTTTTTAATACATATTGTTTTGGGGGTCATTTAAATAGTGATGTTAGAGCATAAAACATGTCTGTCTTGGATATAAACAGATTTCCACATATTTCTAGAGCACTTGTCTGCTCATTTGTTAATTCCAAATAGGAAAGTGGCTAATGTGAGTGTGTGTTGATCCTGAAGTTCAGAATTGTAAAGGAAACTTGACCAGAAGTTGATGAAGGCAGTTTGCTTATGCTAAAGTTTTTTTTGCCATTCTACTGATGGAATTAAGGGATTAAGACATAATTAAACAGTTAATCTACATGAACAGGACAGATATATTTAGATATTAAGATAACTTGAATTGAGGGACTAAACTTGTTGGTTTTCTTTGAGGAGTCCGTA[T/A]GAGGGAGAGGGTCGAGATGAGGCCAGCAGGTGAGGACAACAACTAATAAAATTGTCCAAACGTGTACTACTCAAATCACTTAATCATTACTTAATTACTGAGAGATTTTTTTAAATTGAATGATTCCTGTTCTGTTACAGCACAAAATGGGTATGAGCAGTCTAAGATAATCAAATGTACACTACTGCTCAAATGTTAAGGGCCTGTAAGATAAGAATATTGAGTTGCTTGCTATGATTAACAAGGCAGCATTTACAGTGCAACCTGAAACTATTCATAGCGCTTCACTTTTTCCACTTTTTTTTAATGTTACAGCCTTATTCCAAAGTGTATTAAATTCATTTATTTCCTCAAAATTCTACACACAATGATTCATATTGACAATGTGAAAAAACATTTTTTTTTTAATTGTTGCAAATTTCTTAAAAATAAAAAAGCTAAAAAATCACATGTACAGAAGTATTCACAGCCTTTGCTCTATACTCTGTTGATGCACCTTT
Associated Phenotype:
Not determined