Busch Lab

ZMP

si:ch73-15n24.1

Ensembl ID:
ENSDARG00000079901
ZFIN ID:
ZDB-GENE-030131-1323
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWA3]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36785 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29161
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109810 Nonsense 11 127 1 4
ENSDART00000113948 None None 139 None 5
ENSDART00000132255 None None 195 8 8
ENSDART00000144299 Nonsense 206 272 9 11
Genomic Location (Zv9):
Chromosome 19 (position 9924078)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9382617
GRCz11 19 9301542
KASP Assay ID:
2261-2971.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTGTTTCTTTCTCAAAGCATGCAGAGCACTCTGAGTCTGATTAGAAGT[A/T]AAGCCTTTGAAATTTCAGTTTTGGAAAAGCAAAAAACGAATAATAGTTTC
Long Flanking Sequence:
TTAATTTTAGCCACTTTTAAACTTAAAACTACTTAAAACTACTGTACTTAAAAAAAAGTTCAGTTTAAGCTTTCTCAAGCCAGCCTAATGTTTGTCTTGACAAACTTTTTAATCTATTTACCTACTGTTTTTACTGTTAATGTTTTTTGAGCTCTGACAGTGGCATCTATTTTGACTTGCACTTCCCTTCTTTAAGCGTATGGAAAGTTGACGTAAAATATTTTGTCCTCTGACAGGGTGGTGAAATCCCGGATAGTGGGGATAGTTGAAGCTGGTGTTGGGGCCATTGGAAAAATAGATATAAACCACTTTAATGAGATGTAAGAACACTTCCAGATCCGGAACTGTACTGGATCAGTGATTAAAATTCAAATGGATGCAGTTTCTTTTATTATGCTCCAAAATTAAACTACTGAGCTAAAATGCATGCATGAATGTCATTTTGAATTGATTTGTTTCTTTCTCAAAGCATGCAGAGCACTCTGAGTCTGATTAGAAGT[A/T]AAGCCTTTGAAATTTCAGTTTTGGAAAAGCAAAAAACGAATAATAGTTTCCTTGTATCATTAAGGTAAGAGCAGTTGTTATCGATTCTAAACTTCAATGCTGTATTAAATCTGATCTCTCATCAAGTATTTGTCTTCTCTCTGTATTTTCCTAGAACTGTTTCTCGACTGATTGTTTTGTCCTGTGATTGTTTTTTTGAAGTGACAGAAAGTAGTACTTTCATGGAAAAACTCTCGGAGTCTGTGGTGTAAGTCCACAATGCAGTGCTGTACTTGTAATTGTTTCTCATCAGTACTGTATATGTATTAAATCTAAATATTGTTGGTCTAGTTTTGTGGAGTGTGATTGAGAATATGAAGCTACATGAAAGCAAATGCTTGTACTTTGTGTGTTACAGGGAGTGGAACAAACTGACTCAGTTAAAAAACCCAAGTGAACAGCGTCATATCATATTAAATCTCGATGTATGGATTACGATTATGGAGTAAGGATGATGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36785
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109810 Nonsense 120 127 4 4
ENSDART00000113948 None None 139 None 5
ENSDART00000132255 None None 195 None 8
ENSDART00000144299 None None 272 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9928582)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9387121
GRCz11 19 9306046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTAGCTCAGATATATTTCATCCTTGGAACTATAACTCTTGGTTCT[G/T]AAAGATTCAAGCGGTTTAACAGGTATCTGTTATTAAACAGTCAAAAGACA
Long Flanking Sequence:
TCGGGAGGGACATTAATGAATTCCCTGAATGAAAGAGCCAAACTGCAGTTAAAGTCCACCATTTAATAATTTGGCAAATAATTCGACTACAGATGTCCATGTAAACACAGTCACATTGTCCGCTGTGGGTGTGTGTTTTGACTCTGAAATTCAGCGCGCCCAAATAGACACTCCCACACCAAGCCTCTTTTCTTCCTCCGACACTCCCCCCTAAACAGAGCTGGACACGCCCACTTTTCTGACTTTTTCCAAAGTAGAGGTGTGAAAACACCCTGCTGAAACGAGGGGGTTTCATGGCCCTTTAAGTATGATTTTTCAGTATTCTTTCTACCACTGTTCAATAGTCTCTGGGCTCTGTTGAATTATGTTGTTTTATTTTTTTTAATGTCATATTTACAATTTCATTTCTATTTTCTAGTAAGATTAAAGTTGAATTTAAGGATTTTCGTGAAGAAGTAGCTCAGATATATTTCATCCTTGGAACTATAACTCTTGGTTCT[G/T]AAAGATTCAAGCGGTTTAACAGGTATCTGTTATTAAACAGTCAAAAGACATTCAATAAATGAAACACATACTAAATGCAAGCACATAAATCATACTTAAAAGGTGCAGTAGGTGAACCACCAAAATGTTAACTGTTAGCATAATATCTTTGAAAACACAGTCCTTTCACTGCCGTTCAAAGCCTTGCCTCCTGACATTATGAACATGCATCTTAAAGACGACAGTAGACAATCTACTAGTTCATGTCATTCGCCAGTTAGAAAACTTTATATGTTTTATAATACTACAATTCTGAATGAAAAACTGTATTATATCCAGCAGGTTTTCTGTTGTGTAGCAAGCAAAACTTGTCATGCTGTGTTCACACCAGACGCGGAACGCGCGGATAAATTGCGATATTCATGCGTAAAAAGCCGTGTGAACTGCGTCACTACGATATCGCGTCGCAGGATGTCTATTCGCGCATTTGCATTGACTTAACATTTAAATCACTCGCGATT
Associated Phenotype:
Not determined