Busch Lab

ZMP

shroom4

Ensembl ID:
ENSDARG00000079900
ZFIN ID:
ZDB-GENE-041111-246
Description:
Wu:fe05h01 [Source:UniProtKB/TrEMBL;Acc:B3DGK9]
Human Orthologue:
SHROOM4
Human Description:
shroom family member 4 [Source:HGNC Symbol;Acc:29215]
Mouse Orthologue:
Shroom4
Mouse Description:
shroom family member 4 Gene [Source:MGI Symbol;Acc:MGI:2685570]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa34061 Nonsense Mutation detected in F1 DNA Not yet available
sa20931 Nonsense Available for shipment Available now
sa20932 Nonsense Available for shipment Available now
sa11547 Nonsense Available for shipment Available now
sa40883 Nonsense Mutation detected in F1 DNA Not yet available
sa38609 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34061
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 51 1634 2 10
Genomic Location (Zv9):
Chromosome 7 (position 25938887)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24500639
GRCz11 7 24771796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTAAACTGTCTCTCCTATAGATAGAAGAGGGAGGAAAAGCAGCTCAGTG[T/A]AAGAAGTTGAGAGTGGGGGATGAACTGGTGAACATCAACGGCTCTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20931
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 357 1634 4 10
Genomic Location (Zv9):
Chromosome 7 (position 25961491)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24523243
GRCz11 7 24794400
KASP Assay ID:
2259-8799.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAAGACAGTGAGCCAGAGCGTAAAGGGTGCAGCATTCAACCTTATTA[T/A]ACCTTGAACTCAGACTCAGGTGGAGATGGCAAAGCAACTGACCATGAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5412
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 393 1634 4 10
Genomic Location (Zv9):
Chromosome 7 (position 25961597)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24523349
GRCz11 7 24794506
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTGGAGGACTATTCAAAATCTSTGGCAGCAGCATCTTCACCTCCTTCA[C/T]AAAGGAATAGGGATGAGAACTTTGATACCAAACTCCGACCTGAACATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20932
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 842 1634 4 10
Genomic Location (Zv9):
Chromosome 7 (position 25962944)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24524696
GRCz11 7 24795853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGGAAAGAGAGCAGGAGAGACTTAAGGAGCAAGAGAAGCTTAGAGAA[C/T]AAGAAAGAGAAAAGGAGAGGTTAAGGAAAGAGAGGGAAAATGAGCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11547
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 968 1634 5 10
Genomic Location (Zv9):
Chromosome 7 (position 25967377)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24529129
GRCz11 7 24800286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTTWTTTTGTTKTTTAAAATATRSCAAATATATTTTACAGGCCCAGTA[T/A]GTTCGGGAACAGGAAAAAACKAGAAARATCAACAGAAACTTCAGCTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40883
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 1449 1634 8 10
Genomic Location (Zv9):
Chromosome 7 (position 25975028)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24536780
GRCz11 7 24807937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCTTAGAGAGATCTCAGAGAGGAAAGAGGAAGATGAGGAGCTCAATTA[T/A]AAGGTGAAAGACCCATCATTGTATAATTCACTTGTTACATTCTTTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38609
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111542 Nonsense 1584 1634 10 10
Genomic Location (Zv9):
Chromosome 7 (position 25978653)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24540405
GRCz11 7 24811562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGCGAGCAGGCCGTCTGCAGAGTGCTGGGATGCTGCCTGACCCCAGAA[C/T]AGATGCGGGACTACGGTCACTTTGTGAAGATGAAGGCGGCGCTACTGGTA
Associated Phenotype:
Not determined