Busch Lab

ZMP

si:dkey-15i8.2

Ensembl ID:
ENSDARG00000079872
ZFIN ID:
ZDB-GENE-070912-385
Description:
Novel protein similar to vertebrate Rap guanine nucleotide exchange factor (GEF) 3 (RAPGEF3) [Source
Human Orthologue:
RAPGEF4
Human Description:
Rap guanine nucleotide exchange factor (GEF) 4 [Source:HGNC Symbol;Acc:16626]
Mouse Orthologue:
Rapgef4
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI Symbol;Acc:MGI:1917723]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13695 Essential Splice Site Available for shipment Available now
sa13883 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3726
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113825 None None 248 None 8
ENSDART00000115138 Essential Splice Site 179 470 5 14
ENSDART00000144046 Essential Splice Site 338 972 9 29
Genomic Location (Zv9):
Chromosome 9 (position 2978582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2974054
GRCz11 9 2980074
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TSTCTCAGATCGGCCCTGAYGCTCATCTGCGGATGATCCTGCGCAAACAG[T/C]GCGTAACCGAGACCTTTTTYAAATGTCCTGGAAGTTTGTTTTTTTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13695
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138 None None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138 None None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
Genomic Location (Zv9):
Chromosome 9 (position 2953895)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2949367
GRCz11 9 2955387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGGGTCTGGGAAACCCTGCGGTCTGTAGACTCAGTCAGACATGGGAGG[T/G]AAGTGTTCCCACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13883
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138 None None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
ENSDART00000113825 Essential Splice Site 119 248 3 8
ENSDART00000115138 None None 470 None 14
ENSDART00000144046 Essential Splice Site 843 972 24 29
Genomic Location (Zv9):
Chromosome 9 (position 2953895)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2949367
GRCz11 9 2955387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGGGTCTGGGAAACCCTGCGGTCTGTAGACTCAGTCAGACATGGGAGG[T/G]AAGTGTTCCCACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined