Busch Lab

ZMP

wu:fk36e11

Ensembl ID:
ENSDARG00000079854
ZFIN ID:
ZDB-GENE-030131-8915
Human Orthologue:
SCYL1
Human Description:
SCY1-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:14372]
Mouse Orthologue:
Scyl1
Mouse Description:
SCY1-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1931787]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28365
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074038 Nonsense 697 855 16 18
Genomic Location (Zv9):
Chromosome 14 (position 48513015)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46590674
GRCz11 14 45577966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTCCTCAGAGGCGGTGAAGAAGCAGAGTTCTGACTGGAGCTCTGGCT[G/A]GGATGCAGACGACAGCTGGTCCAATGAGAAAGATGCAGATGGTCAGGGTC
Long Flanking Sequence:
TTATATTATTAATCACCTCCAGAACTGTCAAAGAGTGCCTGTGCTCTGCGTCTCACACCTTCAAACACCACCACGCATTCATTGCGTATCAGCATCGTCTTCTGAGGCGTAAGTAATTTATTAAATACAGAAAAGATTCACGCAGCTTCTCCTACTACAGCAAACCCAGCGTCAGTCAATCTGGAATTGACGATTTTGTTTTCTTTGACTCGTTGGATTGAAACGGTGCTTTATTCAGACGTCGTGCGATATGTCAGTTTGCGCATAAAGTTTGCATTCTTGGATAGAAACATAGCTAGTAACTCATTTCACTTTATCATGCACTTTTACAACCTTTTACATTCACACATCACTTTATCATACACCACATGAAATGTAATATCCCTAAGAGCACGAATGGGCGCAGTAATAGAGCTGATATCCTCATCTGATCTTCCTACAGGTAGGCCGAAAGTCCTCAGAGGCGGTGAAGAAGCAGAGTTCTGACTGGAGCTCTGGCT[G/A]GGATGCAGACGACAGCTGGTCCAATGAGAAAGATGCAGATGGTCAGGGTCAAAGTTCACCTGCTGATGAGGGCTGGGGAAACGACTGGGATGAAGACGGGACTCTGGCCGAGAGTTTCGCACCAACACCTCGAATTAAATCATCAGCCGCTACAAAGAGTGCCAGCTCTGCACAGGATGGGGTTCGACTGGCCAGCGATTACAACTGGGACGGAATGGAAGGAAAGTCCACAACATCTGATCTGCTGTCCAGTGTGTCTCAGCGAAGTGCTACGGTAAGCCTATGCTAATGGGGTATATGAACATGGACTTTCATTTTCAGTCAGCCAGCCCAAACACTTCTGGTGAACTGTCACTGTTGAAAAAAACGAAGTTGATGTGGGTCATTTTCAGAGTCGCTGTTACTCCCCGAAAACACTGATGTCATGTGAAAAAGTCACTGCTAGTTATTAGATTTCATCTTAACAATATCACCATCAACAAAACCATCTTTAGGATGTG
Associated Phenotype:
Not determined