Busch Lab

ZMP

si:ch211-39f22.2

Ensembl ID:
ENSDARG00000079840
ZFIN ID:
ZDB-GENE-090313-115
Description:
calcium-activated potassium channel subunit alpha-1 [Source:RefSeq peptide;Acc:NP_001139072]
Human Orthologue:
KCNMA1
Human Description:
potassium large conductance calcium-activated channel, subfamily M, alpha member 1 [Source:HGNC Symb
Mouse Orthologue:
Kcnma1
Mouse Description:
potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene [Source:MGI

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa15809 Essential Splice Site Available for shipment Available now
sa16902 Nonsense Available for shipment Available now
sa22259 Essential Splice Site Available for shipment Available now
sa11910 Nonsense Available for shipment Available now
sa35448 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38929 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3872
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 195 1029 6 26
ENSDART00000122557 Nonsense 367 1229 9 30
ENSDART00000143200 Nonsense 350 1184 9 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16815072)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16635107
GRCz11 13 16766099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTGCCAGCTACGTCCCTGAAATCATAGAGTTAATAGGAAACCGCAAG[A/T]AATATGGTGGTTCCTATAGTGCGGTAAATGGCAGAAAGTAAGTATTCCAG
Long Flanking Sequence:
GACACTAATGAGTCTTAATGTGCTTTGCAGCTGTGGGCCATCAGGCTGGACTATTCAAATCCACTTGCCACTGCATTAGTGTTTGTTGGACAAAACATGGCATGTAGGTTTTTTTTTCTCTTGCTTTTCACAAGACAGCTTTTTGCTCTGTCAGAGAAAACAGATGGACAGCACTACAAATGCTATCTGCGGTCCAGTGGAGTGTCTCCAAAGTTGGCTTTTTGTCCATGATTCAATTTCCCCCTCAATTTAAATGAAAAATTGACTTTTTTACTGTATATCATTTAGATATGATCAGTTTTCATTTGTTTTATTTAATTTTTTTTCCAACAAAATACATGTCAATTTCTAGATCTCAGCGGTCGGGGAAAAAAAATTTCCAGACTCGTACGGGTCTCTCCGCTCTCTTTTTTAGCCTCTGCTTCTGTCTCCCATCTTCTCCTTAGGCCATGTTTGCCAGCTACGTCCCTGAAATCATAGAGTTAATAGGAAACCGCAAG[A/T]AATATGGTGGTTCCTATAGTGCGGTAAATGGCAGAAAGTAAGTATTCCAGGTGCCTCTGTGGCTTTGGTCACAGCAGAACCCCTCTTTGCATGCCCTTTTCTTTTTCTGTTCCATGCATGTAGGCCATGTTTGCTCGCTACGTGCCAGAAATTGCTGCTCTCATCCTTAATCGGAAGAAATACGGAGGGAGTTATAACTCGACACGAGGCAGAAAGTAAGTCAAAATCCAGAACAGGTGTGGTTGTGTGACTCACGCACCCCCATCTCTGATAGAGAGAAATGGGGTTAGTGAAGACAAAAAAAAAAAAAGATAGGATAAATGAATGTCACACTGTGACTGGAGACCTTGGCCATCGAAGCCACATGTCCATGCCCTTTGCTCTGTGTCCATGGCTTCTTTTCCGTAACACATCTGCTGCATTTTAATTTCATTACAGTGACTACTGTTGGTTTTCCATCCGTTACTGTATGTGCTGCCGTAGAATCAATGTTTGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15809
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Essential Splice Site 307 1029 10 26
ENSDART00000122557 Essential Splice Site 479 1229 13 30
ENSDART00000143200 Essential Splice Site 462 1184 13 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16849825)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16669860
GRCz11 13 16800852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAKRCTATTTTAAATTACCCATACTTTAATAGCTTTTCTCCTTTTTAC[A/T]GAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACAYAA
Long Flanking Sequence:
TGAATGGATTGAATTAGGGTGGCATGGTGGCTCAGTGGTTAGCATGCCTCACAGCAAGAAGGTCACTGGTTCAAGTTCCAGCTGGGCCAGTTGGCATTTCTATGTGGAGTTTGCGTGTTCTCCTCATGTTTGCGTGGGTTTCTTCCGAATTTCCTCCACAGTCAAAAAACATGCAGTATAACTGGTTTGCGGCTGGACGGGTATGCGTTGTGTAAAACATATGCTGGATTAGTTGGCGGTTCATTCTGCTGTGGTGACCTCTGAAATAGAGGCTAAGCCGAAGGAAAATGAATGAATGGATTTTTTTTGATTGATTGATCAATTAATGATTAATTGATTGTGGTAAACTAGAAAATGATTTTTAAGAAAATTCATGTTATTGCAGACCAATCAAAATACTTTCTCAAGCTCTGCTTTACTCCCAATACTCCCCGTCACCACATATTCTATTTCATGCTATTTTAAATTACCCATACTTTAATAGCTTTTCTCCTTTTTAC[A/T]GAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACACAAATGTTGCAGTACCACAACAAGGTAGGAGGTGTTTTTTGTTTTCAACAATAAAATTAAAACTCACAATAAAACACATGAATGTTATAAATAAAATACTTTTCAGAAAATTGTCCACATGAATTAAAAATCAAAATAAGTCTACGTGATTTTCTTTCCCTCAGTGTTATCCCCTATTATAGCAACATGAACACAGCTTTGTATTCATCAGAGAGTGCTGGAGACAGAAGATGGATGTTAATGACTTGATGGATGTTTCTTGTTCATGGGACAGTTCGCTCGAGAGCGATTGAATGTCAACTGTAGATGACTGTTTTAGAGGACTGTCAGAGAACACGCTGTGTTAGCAGTGAGATATGAAATAGTGACATGCTACTGTTATGAGACTTGCGTTATCAGTTTGACAGATTTATAAAATCTAACAAGATAGGAGAGACCAGGGATTGTCGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16902
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 323 1029 10 26
ENSDART00000122557 Nonsense 495 1229 13 30
ENSDART00000143200 Nonsense 478 1184 13 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16849873)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16669908
GRCz11 13 16800900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACWGAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACA[C/T]AAATGTTGCAGTACCACAACAAGGTAGGAGGTGTTTTTTGTTTTCAACAA
Long Flanking Sequence:
TCACAGCAAGAAGGTCACTGGTTCAAGTTCCAGCTGGGCCAGTTGGCATTTCTATGTGGAGTTTGCGTGTTCTCCTCATGTTTGCGTGGGTTTCTTCCGAATTTCCTCCACAGTCAAAAAACATGCAGTATAACTGGTTTGCGGCTGGACGGGTATGCGTTGTGTAAAACATATGCTGGATTAGTTGGCGGTTCATTCTGCTGTGGTGACCTCTGAAATAGAGGCTAAGCCGAAGGAAAATGAATGAATGGATTTTTTTTGATTGATTGATCAATTAATGATTAATTGATTGTGGTAAACTAGAAAATGATTTTTAAGAAAATTCATGTTATTGCAGACCAATCAAAATACTTTCTCAAGCTCTGCTTTACTCCCAATACTCCCCGTCACCACATATTCTATTTCATGCTATTTTAAATTACCCATACTTTAATAGCTTTTCTCCTTTTTACAGAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACA[C/T]AAATGTTGCAGTACCACAACAAGGTAGGAGGTGTTTTTTGTTTTCAACAATAAAATTAAAACTCACAATAAAACACATGAATGTTATAAATAAAATACTTTTCAGAAAATTGTCCACATGAATTAAAAATCAAAATAAGTCTACGTGATTTTCTTTCCCTCAGTGTTATCCCCTATTATAGCAACATGAACACAGCTTTGTATTCATCAGAGAGTGCTGGAGACAGAAGATGGATGTTAATGACTTGATGGATGTTTCTTGTTCATGGGACAGTTCGCTCGAGAGCGATTGAATGTCAACTGTAGATGACTGTTTTAGAGGACTGTCAGAGAACACGCTGTGTTAGCAGTGAGATATGAAATAGTGACATGCTACTGTTATGAGACTTGCGTTATCAGTTTGACAGATTTATAAAATCTAACAAGATAGGAGAGACCAGGGATTGTCGCAACACATTTTGTTTTGACAGCGTATGTGTTTTATACAATATAATATGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Essential Splice Site 419 1029 13 26
ENSDART00000122557 Essential Splice Site 591 1229 16 30
ENSDART00000143200 Essential Splice Site 574 1184 16 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16860128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16680163
GRCz11 13 16811155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAGCTAAATGTTTTTCTTCTGTACACTTAATATATTTTTGCTTTTTTC[A/T]GGCTGTGCTACGTGAAGCTCAAGTTGCTGTTGATCGCTATTGAGTACAAG
Long Flanking Sequence:
ATTTATTATGACATATCAGTTATTAAAACTTACTTAATATTACTAAGTTTTCAAAAATTAGAACATATTTAAATATTACAAGTAAATTAATATTTATCATTAAAAATAACTAAGTAATGCAACTAGTTACTTTTACTAGAGTAACTTTATAATGCATTCATTTCAGAAGTAACTTTCCCCAACACTTGTGGTAAGTATTGTACCATAAAGATCTTGCTTTTTTATATACTGCCAGATGTACTGCACATCCAGATGTACATTTTCATTAACAAAGCCATTTGTTTGACATCAGTCAAACGTGAATGTGAAATTGCTGCACGACATAAACACAGCCAATTGAAAGTAATTAGATTTTTATCCACTATTATGTCAAGCTGGGTCTCAAAGCCTTGTTTTGATGGCAATATATTAACATGAAATAGTTTTAAAGGTTATCACCATGTGAATCTAGCTAGCTAAATGTTTTTCTTCTGTACACTTAATATATTTTTGCTTTTTTC[A/T]GGCTGTGCTACGTGAAGCTCAAGTTGCTGTTGATCGCTATTGAGTACAAGTCAGAGCAAAGGGAAAGCAGGTTTGTTCTCTGTTGGTCTTGGCCATTTACAATACACCAACCAAAGAGGGACAAAGCATTTGTGTCCCTCATTGGTTCTACATACCCTCTACATTATAGTTCTATTAGCTAGACAGAAATTTAGGCAGAGTTTTCAGCAAGCAATTAAATTTGGTTTCAAACTGAAATCGCTTTTATTGAGACAGCAGCATTTTACGTTCCATAAGTAGAGGAAGTTCGCCTCAACTTGACTCTCACAGCATCACAGTTGCCGATCACTGTAAGAGTCACCGCAAAGCCAAAGGGCCATGACATCTGCTCAGACTCACTGTGCTGTATTGATGAGGGTTTACTCTCAGAGTAAAAAGCCTTCTATCAATAGCACTCCTGTGGCATTCTGTTAAGTGACCCATTGGAACTAATAACATGAAGTACTCTGTCTCAGTAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 626 1029 18 26
ENSDART00000122557 Nonsense 798 1229 21 30
ENSDART00000143200 Nonsense 781 1184 21 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16904489)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16724524
GRCz11 13 16855516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCATTACCATGAGCTAAAGCCCATTGTGTTTGTGGGCTCGTTAGATTA[T/A]CTGCGAAGAGAGTGGGAAACCCTTCACAACTTCCMCAAAGTCTTCATCTT
Long Flanking Sequence:
ATAAATATAACTGTTTAATTAAACTGCTTTGTTAAATATATGATCTATGTTCACTGAAAACGGATACATATATACATTTTTTCATATACATTGCTTTTCTTTTTCTTTAAATGGTTATTTTCCTGATCACATTTGTCTTTACTAAATGAAATCCATTTTGACCACCTTTATTAGATGCATTTTATATTGCAAAAAAATCCTTTTTATTTTAAACAATACATAACTGCTTCATCTTGTGTTGTACTTGGATGACAGTAAATGAGATGTTTTTTTCCTTCTTGGTGATGAGATTGTAAATGTCTTGTTTGTTTTCTTTTTTCCCTACCACAGACACGCAGCGAGGCCTCAATGACGGTTTTAAGTGGACATGTCGTAGTCTGCATATTTGGAGATGTCACGTCAGCTTTAGTGGGGCTTCGAAACTTAGTCATGCCTTTGAGAGCAAGCAACTTCCATTACCATGAGCTAAAGCCCATTGTGTTTGTGGGCTCGTTAGATTA[T/A]CTGCGAAGAGAGTGGGAAACCCTTCACAACTTCCCCAAAGTCTTCATCTTACCTGTGAGTGCATGCATTGAACAATGAGCTGTCTGTAAATATAATGCATTCATGTGACTCGAGTAGGACATTATTTTGCAGCATGTTTACTTTTACAATTATTTTGCATTAAAAAGTGCCATTTTTTTTAAGTGCAGCAGGTTCCGTGTGAATCTTTTACTTGGTTTCTTGCTCTAGTGCTTGTTAGCGTTGGCTTGACTGAGTATGAAAAACGGAGCCTTAAAGCTGCCGTCAGCAAAGGCTAGCCTTTAGATTAGACTACATCTCTTCTTCCCTCAGCACATAGTTAGATCAGCTGAATGTCACTGCCTTTAGAAAAGTAAATACTTGTTAACTAATTTCCTTGAGCTCCCGCGCTGTCTTTAATTTGTTTCTCTCTTTCATCCTCCTCTTTTCTTCTCTCTCTCTGCTGAAGGGTACGCCATTAAGTCGAGCTGATTTAAGGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35448
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Essential Splice Site 644 1029 18 26
ENSDART00000122557 Essential Splice Site 816 1229 21 30
ENSDART00000143200 Essential Splice Site 799 1184 21 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16904545)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16724580
GRCz11 13 16855572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGAGTGGGAAACCCTTCACAACTTCCCCAAAGTCTTCATCTTACCTG[T/G]GAGTGCATGCATTGAACAATGAGCTGTCTGTAAATATAATGCATTCATGT
Long Flanking Sequence:
AAAACGGATACATATATACATTTTTTCATATACATTGCTTTTCTTTTTCTTTAAATGGTTATTTTCCTGATCACATTTGTCTTTACTAAATGAAATCCATTTTGACCACCTTTATTAGATGCATTTTATATTGCAAAAAAATCCTTTTTATTTTAAACAATACATAACTGCTTCATCTTGTGTTGTACTTGGATGACAGTAAATGAGATGTTTTTTTCCTTCTTGGTGATGAGATTGTAAATGTCTTGTTTGTTTTCTTTTTTCCCTACCACAGACACGCAGCGAGGCCTCAATGACGGTTTTAAGTGGACATGTCGTAGTCTGCATATTTGGAGATGTCACGTCAGCTTTAGTGGGGCTTCGAAACTTAGTCATGCCTTTGAGAGCAAGCAACTTCCATTACCATGAGCTAAAGCCCATTGTGTTTGTGGGCTCGTTAGATTATCTGCGAAGAGAGTGGGAAACCCTTCACAACTTCCCCAAAGTCTTCATCTTACCTG[T/G]GAGTGCATGCATTGAACAATGAGCTGTCTGTAAATATAATGCATTCATGTGACTCGAGTAGGACATTATTTTGCAGCATGTTTACTTTTACAATTATTTTGCATTAAAAAGTGCCATTTTTTTTAAGTGCAGCAGGTTCCGTGTGAATCTTTTACTTGGTTTCTTGCTCTAGTGCTTGTTAGCGTTGGCTTGACTGAGTATGAAAAACGGAGCCTTAAAGCTGCCGTCAGCAAAGGCTAGCCTTTAGATTAGACTACATCTCTTCTTCCCTCAGCACATAGTTAGATCAGCTGAATGTCACTGCCTTTAGAAAAGTAAATACTTGTTAACTAATTTCCTTGAGCTCCCGCGCTGTCTTTAATTTGTTTCTCTCTTTCATCCTCCTCTTTTCTTCTCTCTCTCTGCTGAAGGGTACGCCATTAAGTCGAGCTGATTTAAGGGCCGTCAACATCAACCTCTGCGACATGTGCGTTATCCTGTCAGCCAATCAGAACAATATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28086
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 None None 1029 None 26
ENSDART00000122557 Essential Splice Site 946 1229 24 30
ENSDART00000143200 None None 1184 None 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16918120)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16738155
GRCz11 13 16869147
KASP Assay ID:
2260-6224.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGGAAAAAAACAGTGGAACCAACATACAAATGATAACAGAACTGG[G/T]TAAGCTGCGCCTTTGTCCTCCGCTACTCTGATGCACTGCCTCCTTCATCG
Long Flanking Sequence:
ATAATTCAAGAGTACTTTTCGAATGTTTATCAGCAGACTGCCAGCAAACCGGACACATTAAGTTCTTTACACGAGCGAATCATTGACCGTCAATGGAGCACTCTGTAAATCTGGTCTGCTATATCAATTTTAGAATATGTGCGATTGCACAAGAAACCTGTTCGGAGTGATTAGTAATTCCGTTCTATATGCTTCATAGTAATCTTCTTGTGCAGTAAGCCTTCGCGATATCCCCGTTATCATGAACAAACACGGCTGAACTGTTCCATAGAGTTTCTCAGAGAAGCGCTTCATCCTGACAGTGTACCTTTAGATTTCTAATCCCACTCTTGACATGATACTCTCGTTTATGCTTTCTCTGGCTTTGAACTTGTTTCAATAACTGTCTCCCCTCAACACTGTTTTATCATCATTAGCTAAGCCTGGCAAACTACTGCCTTTGGTTTCATTCAGTCAGGAAAAAAACAGTGGAACCAACATACAAATGATAACAGAACTGG[G/T]TAAGCTGCGCCTTTGTCCTCCGCTACTCTGATGCACTGCCTCCTTCATCGGCTTGTCTTGATTTCTCCCGCTGCAGCTGAGGCCTGCTCCCATGGCATCACTTTGAACACATTTTTATCCTTAGTTCTGGTTGAAATTGACTGTCTTGTTTTTGGCCTTTTTTTTTTTTAAAGGATTTTTTTTTTCTTTCTTTCTTTCTCAGAGCATCACTAGGCCTTTGATCATGCGAGTCTGTCCTTGTGGCTGTTTTCATAGCATCTCCCAGCAGTTCAATTCTTTGGCCCAGGCTCCTTTTCATCAGCGGCCTGTCTGAAAGACTGACATTTCTCTTCCTTAGCTCACAGGAAGTCTGGGAAGAAATCAAATTAAAAAAAAGAGAAAAGAAAACAGATCAAACCTTGCTTTAAGCTGTTTATTGTTATTTATTTATTTTGGTGCTGGCCCTAATCTCTGAAGCATAGATTTTGAAAGGGGGTGAAACAAAGATTGTGTGAGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114192 Nonsense 983 1029 26 26
ENSDART00000122557 Nonsense 1183 1229 30 30
ENSDART00000143200 Nonsense 1138 1184 29 29

The following transcripts of ENSDARG00000079840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 16934680)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16754715
GRCz11 13 16885707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCGTCTTCTACTTGTCTCCTGCCCTGGCTGTCTCCCAGAAAAGAGAT[G/A]GTTTACAGATGAAGCAGAAAACGCATACCCAAGGAACATTCAAATCAAGC
Long Flanking Sequence:
GGCGTGACACTCTCCCCCCGCGGCTCACCGCAGCCTGACACTCCAAGGTGTGCAGCACATTTCAACTTGGAGGAATAGTTGGAGTGCTGAAAAATGACACCGCCTAGGAGAAATGTGATGAGGACGTACTCTATGTGTGGCTTAAAGTTCTCAAATGAAGCGCTTTCCAATAAACGGCTGATTCCGGAGACCTGTAAACATCCTCAGATACATGGCATGATACAGTCATTCCTTTTGGCTACAGTACGCCCTTGTTTAAACGCTTTTACATACCGTACTGTGCTGCCTCATGAAATCAGTAATAGGTCCAACAATGTGTGTTTCACCCTGTGTCCTTCTGAATGTGATCATGTATAGAGTGTGAGAATGAGAGCGTGGTGGGTTTTTTTTTTTTTTTTTAGAGAGAGATATGCATGACCCTGCTGTACAGATCTGATTTTAACACTATGTTTCTCGTCTTCTACTTGTCTCCTGCCCTGGCTGTCTCCCAGAAAAGAGAT[G/A]GTTTACAGATGAAGCAGAAAACGCATACCCAAGGAACATTCAAATCAAGCCTATGAGCACTCACATGGCCAACCAAGTCAATCAGTACAAATCCACTAGCAGTCTGATTCCACCTATCCGAGAAGTCGAAGACGAATGCTGAACAAATCCCCCGGCCTTTCTTATCACTGAGGGAACTTGGGTCATCCTGCTGTAAAAGACGAGCGCTATTCGTGAAACGCTGACTGTGATGACGCCGACACATTGTTCTTCCCTTGTTCCACTCGAGGGTTCGAAGCGATCGAGGACTAGAAGGGACTTCCTATGTGTATACCTTTAATGTTACTTCCATACTTTTGTATATGTATACATAGTGATGTACATAATGACAATCAAGTAAGGATTGTACAGCCCCTAGCACTTTTTAAAATAACAGGCGAACAAAAAAGAAAAAAAAATAGAAGAAAAAAAAGATACTTCCTGTGATTCTTTGCATTATCTCACCTCTGCTGTGACCTGAC
Associated Phenotype:
Not determined