Busch Lab

ZMP

zgc:195062

Ensembl ID:
ENSDARG00000079796
ZFIN ID:
ZDB-GENE-081022-178
Description:
hypothetical protein LOC566336 [Source:RefSeq peptide;Acc:NP_001124257]
Human Orthologue:
C2orf43
Human Description:
chromosome 2 open reading frame 43 [Source:HGNC Symbol;Acc:26145]
Mouse Orthologue:
1110057K04Rik
Mouse Description:
RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23114 Nonsense Available for shipment Available now
sa32161 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23114
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115296 Nonsense 288 370 6 7
Genomic Location (Zv9):
Chromosome 17 (position 30872621)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30796548
GRCz11 17 30813511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCTGTTTTTGTCTCTGTTTCTGCAGCCAACGGTATGTACATGGGGAGC[C/T]AAGAAATGAGATTGGTTGTTGAAAGAGACAACGCAACCATACATCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32161
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115296 Essential Splice Site 308 370 7 7
Genomic Location (Zv9):
Chromosome 17 (position 30875917)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30799844
GRCz11 17 30816807
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTCAGTTAAAGTCTTAACTGGGCTGTTCGTTTTGTGTTTTCCTCCATC[A/T]GATTATTTTTTACTATGGAGCCACGGATCACTGGTGTCCAGTAAAGTATT
Associated Phenotype:
Not determined