Busch Lab

ZMP

vmhcl

Ensembl ID:
ENSDARG00000079782
ZFIN ID:
ZDB-GENE-061027-393
Description:
ventricular myosin heavy chain-like [Source:RefSeq peptide;Acc:NP_001070932]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa18394 Nonsense Available for shipment Available now
sa6839 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19748 Nonsense Available for shipment Available now
sa19749 Essential Splice Site Available for shipment Available now
sa39820 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16260 Nonsense Available for shipment Available now
sa39821 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25803
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 88 1943 2 37
ENSDART00000123064 Nonsense 83 638 4 17
ENSDART00000123565 Nonsense 88 242 4 8
ENSDART00000128784 Nonsense 88 1936 4 39
ENSDART00000137560 Nonsense 88 99 2 2
ENSDART00000141922 Nonsense 88 167 3 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23576784)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24631711
GRCz11 2 24287362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAGAGGCAGATGTTCTGCAACAGAACCCTCCCAAATTTGATAAAATT[G/T]AAGACATGGCAATGCTGACCTTTCTCCATGAGCCAGCAGTGCTGTTTAAC
Long Flanking Sequence:
ATCAAGACATAACATTAAAATGACTCTAAAAACCATGTTAATCACGTGTTATGATTGATTTAAATACTTTACTGTTTTACACTTTTTTCAACTGCAAAAATAACAGTACTTTTTTTAAAGGCAAAAGAGTGTATCACAAACTTTAAATCTGGCCCCTTTTTTTTTTTTTTAAATCTACATTTATTAAGTTTAACTGAATTTAACTGGCATTATTTTTCCCCCAATATATCATATCTATGCTATCTTTAAATGTGGGATGTTTGTGTATGGTCGGAGGGGTCCAATTTTACTGCATGTAACAGTGTTGACAAATAAGGGCTTATAATCATCATCATATTTCTGTCACAACTTTAAAGTCATACTGCATTTTTATCGGGTTTTCAATTTGATAAAAAATAAATAAATCAATCAAATTAATGCTAAACCTTTATCCTTTGTAGACTGTGACTGTCAAAGAGGCAGATGTTCTGCAACAGAACCCTCCCAAATTTGATAAAATT[G/T]AAGACATGGCAATGCTGACCTTTCTCCATGAGCCAGCAGTGCTGTTTAACCTCAAAGAGCGCTATGCAGCATGGATGATCTATGTGAGTATACTAAAATCTCAGCTTAATCTCTGCAACCAAATCTTTACTTTAAATCAAAACTTCAACACTTTTGTTCCACAGACCTACTCAGGGCTGTTTTGTGTCACTGTCAACCCCTACAAGTGGCTGCCGGTGTACAATCAGGAGGTTGTTATAGCCTATAGAGGGAAAAAGAGGACTGAAGCTCCTCCCCACATCTATTCTATCTCTGACAATGCCTACCAATACATGTTAGCAGGTAATACTGACAAAAATTTATACTTTTATAAAAAATGGAATAAGAACCTTTTAATAATTAATTAATAGTAAATGATTCTGTCCTTTTACAGACAGAGAAAACCAGTCTATCCTTATCACGTGAGTAATAAAACGCCCCACATGTAAATATGATGCAATATGTTATTTCAGATAGATATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5138
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 134 1943 3 37
ENSDART00000123064 Nonsense 129 638 5 17
ENSDART00000123565 Nonsense 134 242 5 8
ENSDART00000128784 Nonsense 134 1936 5 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 Nonsense 134 167 4 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23577005)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24631490
GRCz11 2 24287141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGGGCTGTTTTGTGTCACTGTCAACCCCTACAAGTGGCTGCCGGTGTA[C/A]AATCAGGAGGTKGTTATAGCCTATAGAGGGAAAAAGAGGACTGAAGCTCC
Long Flanking Sequence:
CAATATATCATATCTATGCTATCTTTAAATGTGGGATGTTTGTGTATGGTCGGAGGGGTCCAATTTTACTGCATGTAACAGTGTTGACAAATAAGGGCTTATAATCATCATCATATTTCTGTCACAACTTTAAAGTCATACTGCATTTTTATCGGGTTTTCAATTTGATAAAAAATAAATAAATCAATCAAATTAATGCTAAACCTTTATCCTTTGTAGACTGTGACTGTCAAAGAGGCAGATGTTCTGCAACAGAACCCTCCCAAATTTGATAAAATTGAAGACATGGCAATGCTGACCTTTCTCCATGAGCCAGCAGTGCTGTTTAACCTCAAAGAGCGCTATGCAGCATGGATGATCTATGTGAGTATACTAAAATCTCAGCTTAATCTCTGCAACCAAATCTTTACTTTAAATCAAAACTTCAACACTTTTGTTCCACAGACCTACTCAGGGCTGTTTTGTGTCACTGTCAACCCCTACAAGTGGCTGCCGGTGTA[C/A]AATCAGGAGGTTGTTATAGCCTATAGAGGGAAAAAGAGGACTGAAGCTCCTCCCCACATCTATTCTATCTCTGACAATGCCTACCAATACATGTTAGCAGGTAATACTGACAAAAATTTATACTTTTATAAAAAATGGAATAAGAACCTTTTAATAATTAATTAATAGTAAATGATTCTGTCCTTTTACAGACAGAGAAAACCAGTCTATCCTTATCACGTGAGTAATAAAACGCCCCACATGTAAATATGATGCAATATGTTATTTCAGATAGATATTTTTTTATCAAATATTTGTGGGAAATAAAATTAACATCTATACTCAGCAAATTAATTTTGATTCAGGATGCCGAGAAATAAACATTGTGGCCATTTCATCTATTTCTGATGATTATTTTGTTGATTTCTGAGCCTAGTGGAGAATCTGGCGCTGGGAAGACTGTCAACACTAAAAGAGTCATTCAGTACTTTGCCAGCATTGCAGCAAGTGGAGGGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25804
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 242 1943 6 37
ENSDART00000123064 Essential Splice Site 237 638 8 17
ENSDART00000123565 None 242 242 8 8
ENSDART00000128784 Essential Splice Site 242 1936 8 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23577708)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24630787
GRCz11 2 24286438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCATTTGGTAATGCTAAGACCATCAGAAATGACAACTCCTCCAGATTT[G/T]TAAGTGATTTCTAAATCAAAAATGCAGAGCATGATCAGTTTTATGCTGCA
Long Flanking Sequence:
CAGTCTATCCTTATCACGTGAGTAATAAAACGCCCCACATGTAAATATGATGCAATATGTTATTTCAGATAGATATTTTTTTATCAAATATTTGTGGGAAATAAAATTAACATCTATACTCAGCAAATTAATTTTGATTCAGGATGCCGAGAAATAAACATTGTGGCCATTTCATCTATTTCTGATGATTATTTTGTTGATTTCTGAGCCTAGTGGAGAATCTGGCGCTGGGAAGACTGTCAACACTAAAAGAGTCATTCAGTACTTTGCCAGCATTGCAGCAAGTGGAGGGAAGAAAGACCAAGACAAGAACAAGGTTTAAATTTAGAAAATAGGCAAAAATATAGCTTCTGATGCTGAAATATTTACATGTATTTTCTTTAATGTAATATTGTTTGCTCATTTAGGGAACACTGGAGGATCAAATCATCCAGGCTAACCCTGCCTTGGAGGCATTTGGTAATGCTAAGACCATCAGAAATGACAACTCCTCCAGATTT[G/T]TAAGTGATTTCTAAATCAAAAATGCAGAGCATGATCAGTTTTATGCTGCATAGTGTACAAATTCTGTAATATTTTGTATTATATTTAGGGTAAATTTATTAGAATTCACTTCGATACAAGAGGGAAGCTGGCATCTGCTGACATTGAAACATGTAAGTCAATGATCATTTCTTACAAACATTTCAAAATAATTTAATCCTGAATGCAATGCGAAATTGTAAATAAATTATAAAAGATAACCTGTATGTTATATAACTTTGTCCAATCTCTAGATCTCCTGGAGAAGTCCCGTGTCACCTTTCAGTTGAAGGCTGAAAGAGACTATCACATCTTTTATCAAATCTTATCCAACAAAAAACCTGAAATCCTTGGTGAGCAAATGAAGAAAATCAGATACTTAATAAATACTAGGGATGTAATGATTCACTGTGAGAATGACAAAATAAAAATGAAAAATAAAAATAAAAATACCAAGATTTTTTCTTAAAAGATGTCTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18394
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 555 1943 14 37
ENSDART00000123064 Nonsense 546 638 16 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Nonsense 551 1936 16 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23579941)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24628554
GRCz11 2 24284205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTGCATGTTTCCCAAAGCCAGTGATGCAAYCTTTAAAGCAAAGCTTTA[C/A]GACAACCATCTTGGGAAATCAAACAATTTCCAGAAACCCAGGCTTGTKAA
Long Flanking Sequence:
CCTCGCCAGTATTTCATCGGAGTATTGGATATTGCTGGCTTTGAGATCTTTGATGTAAGTACTGAATGCCTAGTTCGACCCAAATTAATTTCCACACAGCAGCATTTCGTCTCATACTGAAACCTGTAGGAACAATTGTGGTTTTCCAATATTTTTTGTTTGCAGTTTAACACCTTTGAGCAACTCTGCATCAACTTTACCAATGAGAAACTGCAACAGTTTTTCAACCACCACATGTTTGTGCTGGAACAAGAGGAGTACAAGAAAGAAGGGATTGAATGGGAGTTTATTGACTTTGGCATGGACTTGCAGGCCTGCATCGATCTCATTGAGAAAGTGAGTCATTAATGATACAAAATGCAAATATTAAAACTGAATTATATGCTATACTTCACCATTACTTATTCCTGACTCCTTCAGCCTATGGGCATCATGTCCATCCTTGAAGAGGAGTGCATGTTTCCCAAAGCCAGTGATGCAACCTTTAAAGCAAAGCTTTA[C/A]GACAACCATCTTGGGAAATCAAACAATTTCCAGAAACCCAGGCTTGTGAAGGGCAAGCCAGAGGCTCACTTTGCTCTTGTTCACTACGCTGGCACAGTAGACTACAACATTAACAACTGGCTGGTGAAGAATAAGGACCCTCTTAACGAAACTGTGGTTGGATTGTACCAGAAGTCCTCTCTGAAGCTGTTGTCTAATCTGTTTGCCAACTACGCTGGTGCAGACTCAGGTGTGCTTTATCAAATAGAATTGCCATCTTTACTAGTAAAGTCATTATATACGACTTATGTCATTAATGTAAAAAAGGGAAAGTTCACCCAAAAAAGAAAATTCTGCCACCATTTACTCATCTTTTACTTTTTGCAAACTTATTTATTTTTGTTTCTGCTGTTGAGCACAAAAGAAAATAATTACAAAAATGCTGATAGTATTAACCCATTAATAGTGCTGGGCTATCAATCAAAAAGTAATCGAAATCAACATTAGGCTACAACCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6839
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 901 1943 20 37
ENSDART00000123064 None None 638 None 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Essential Splice Site 894 1936 22 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23583582)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24624913
GRCz11 2 24280564
KASP Assay ID:
554-5235.1 (used for ordering genotyping assays)
KASP Sequence:
AATACAAGATCTGTATGCAGGTAATGCATTATCTATTAAATATATTTAAC[A/C]GGAGCAAGACAACCTCTGTGATGCTGAAGAAAGGTGTGAAGGTCTGATCA
Long Flanking Sequence:
AATCACAGGCATTCAAGCCAAGTCTCGTGGTCTTCTCTCAAGGGCTGAATACATAAAGATGGTAGAACGCAGGTACTGATTATCCTATACTTAAACAAGTAATGTGTGCTGTTGTCTTTTTTAATGGTGTTTGATTATGTTTTTTTGTGTTTTCTACTAATAAAAAAAGGGATGCCTTACTTGTGATTCAGTGGAATGTGCGTGCATTCATGGCGGTCAAGAACTGGCCCTGGATGAAGCTCTTCTTTAAAATCAAACCATTGCTGAGATCTGCTGAAGCAGAAAAGGAAATGGCCAATATGAAAGAAGAGTTCTTGAAGCTAAAGGAAGCTTATGCGAAGTCTGAGGCACGTAGAAAAGAACTTGAAGAAAAAATGGTGACTCTTCTCCAAGAAAAGAATGACCTACAACTTCAAGTGCAAGCGGTATGTTTGTAAAAAAAAAATCATAAATACAAGATCTGTATGCAGGTAATGCATTATCTATTAAATATATTTAAC[A/C]GGAGCAAGACAACCTCTGTGATGCTGAAGAAAGGTGTGAAGGTCTGATCAAAAACAAGATTCAGATGGAGGCTAAAGCCAAAGAGCTCACAGAGAGACTTGAGGATGAGGAGGAGATGAATGCAGAGCTGACAGCTAAGAAGAGAAAGCTGGAGGACGAATGCTCTGAGCTGAAGAAGGATATTGATGATCTGGAGCTCACTCTGGCTAAAGTGGAGAAAGAGAAGCATGCTACTGAGAACAAGGTTTCAGACAAACAATAATTTACTGTGAAGAGAAGTCCATTTGTCTGATGTTTACTTATTACTAGCTTTTCACACACAGGTGAAGAACCTGACAGAAGAAATGGCAGCTTTAGACGATATCATTGCTAAACTGACAAAGGAGAAGAAAGCCTTGCAGGAAGCTCATCAGCAGACACTGGATGACCTGCAGAGTGAGGAGGACAAAGTCAACACCCTCACCAAGGCAAAAGTAAAACTAGAGCAACAAGTGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19748
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 1110 1943 23 37
ENSDART00000123064 None None 638 None 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Nonsense 1103 1936 25 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23584459)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24624036
GRCz11 2 24279687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCAGTCAGCTCAACAGTAAAATCGACGATGAGCAAAGCATAATTATC[C/T]AACTCCAAAAGAAACTCAAGGAGTTGCAGGTACATTGACCATACGTGATG
Long Flanking Sequence:
GACAAAGGAGAAGAAAGCCTTGCAGGAAGCTCATCAGCAGACACTGGATGACCTGCAGAGTGAGGAGGACAAAGTCAACACCCTCACCAAGGCAAAAGTAAAACTAGAGCAACAAGTGGATGATGTGAGTAAGCATTGTTTTTGACGTAGCATTCAGTTGTGATGAAGTAAACTACAGTACTACATTAAGAACTTCTGTTGCTAATTCTGTTAGCTTGAGGGATCTCTAGAGCAAGAAAAGAAAATCCGAATGGATCTAGAAAGAGCCAAGAGGAAACTTGAAGGAGATCTGAAGTTAACCCAGGAGAGCATAATGGACCTGGAGAATGACAAGCAGCAACTGGAAGAAAAACTGAAGAAGTAAGACACACTGCTTAATTATTATTGTTGTTTTACATGTTTTGAATGCCTTAAACGAATTCCATGATTTCAATTTCAGGAAAGACTTTGAAATCAGTCAGCTCAACAGTAAAATCGACGATGAGCAAAGCATAATTATC[C/T]AACTCCAAAAGAAACTCAAGGAGTTGCAGGTACATTGACCATACGTGATGTTCTGTTCATCTTTGTAGTGTGCATTTTTAAGAAAAAATGTATCTTCTCCTTTATGCTAGGCGAGAGTTGAGGAGCTGGAGGAAGAGCTTGAGGCAGAAAGAGCTGCCAGAGCCAAAGTGGAGAAACAGAGAGCAGATTTAGCCAGAGAGCTGGAGGAGATCAGCGAGAGACTGGAGGAGGCTGGAGGAGCTACAGCTGCTCAGATTGAGATGAATAAGAAACGAGAGGCAGAGTTTCAGAAGCTCCGCAGAGACCTTGAAGAGGCCACTCTGCAGCATGAGGCCACTGCCGCCACACTCAGGAAAAAACAAGCCGACAGTGTGGCTGAACTTGGAGAGCAGATAGACAATCTGCAGAGGGTCAAGCAAAAACTGGAAAAGGAGAAAAGTGAACTTAGGCTGGAGTTGGATGATGTAGCCTCCAGCATGGAGCATATTGTGAAGTCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19749
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 1119 1943 23 37
ENSDART00000123064 None None 638 None 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Essential Splice Site 1112 1936 25 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23584490)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24624005
GRCz11 2 24279656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGCAAAGCATAATTATCCAACTCCAAAAGAAACTCAAGGAGTTGCAGG[T/C]ACATTGACCATACGTGATGTTCTGTTCATCTTTGTAGTGTGCATTTTTAA
Long Flanking Sequence:
CATCAGCAGACACTGGATGACCTGCAGAGTGAGGAGGACAAAGTCAACACCCTCACCAAGGCAAAAGTAAAACTAGAGCAACAAGTGGATGATGTGAGTAAGCATTGTTTTTGACGTAGCATTCAGTTGTGATGAAGTAAACTACAGTACTACATTAAGAACTTCTGTTGCTAATTCTGTTAGCTTGAGGGATCTCTAGAGCAAGAAAAGAAAATCCGAATGGATCTAGAAAGAGCCAAGAGGAAACTTGAAGGAGATCTGAAGTTAACCCAGGAGAGCATAATGGACCTGGAGAATGACAAGCAGCAACTGGAAGAAAAACTGAAGAAGTAAGACACACTGCTTAATTATTATTGTTGTTTTACATGTTTTGAATGCCTTAAACGAATTCCATGATTTCAATTTCAGGAAAGACTTTGAAATCAGTCAGCTCAACAGTAAAATCGACGATGAGCAAAGCATAATTATCCAACTCCAAAAGAAACTCAAGGAGTTGCAGG[T/C]ACATTGACCATACGTGATGTTCTGTTCATCTTTGTAGTGTGCATTTTTAAGAAAAAATGTATCTTCTCCTTTATGCTAGGCGAGAGTTGAGGAGCTGGAGGAAGAGCTTGAGGCAGAAAGAGCTGCCAGAGCCAAAGTGGAGAAACAGAGAGCAGATTTAGCCAGAGAGCTGGAGGAGATCAGCGAGAGACTGGAGGAGGCTGGAGGAGCTACAGCTGCTCAGATTGAGATGAATAAGAAACGAGAGGCAGAGTTTCAGAAGCTCCGCAGAGACCTTGAAGAGGCCACTCTGCAGCATGAGGCCACTGCCGCCACACTCAGGAAAAAACAAGCCGACAGTGTGGCTGAACTTGGAGAGCAGATAGACAATCTGCAGAGGGTCAAGCAAAAACTGGAAAAGGAGAAAAGTGAACTTAGGCTGGAGTTGGATGATGTAGCCTCCAGCATGGAGCATATTGTGAAGTCCAAGGTGAATTGAATTGCTTGACTTTTTTAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39820
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 1249 1943 24 37
ENSDART00000123064 None None 638 None 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Essential Splice Site 1242 1936 26 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23584960)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24623535
GRCz11 2 24279186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGTTGGATGATGTAGCCTCCAGCATGGAGCATATTGTGAAGTCCAAG[G/A]TGAATTGAATTGCTTGACTTTTTTAAAAGAACAACGAAATTACAATTCAA
Long Flanking Sequence:
AACTCCAAAAGAAACTCAAGGAGTTGCAGGTACATTGACCATACGTGATGTTCTGTTCATCTTTGTAGTGTGCATTTTTAAGAAAAAATGTATCTTCTCCTTTATGCTAGGCGAGAGTTGAGGAGCTGGAGGAAGAGCTTGAGGCAGAAAGAGCTGCCAGAGCCAAAGTGGAGAAACAGAGAGCAGATTTAGCCAGAGAGCTGGAGGAGATCAGCGAGAGACTGGAGGAGGCTGGAGGAGCTACAGCTGCTCAGATTGAGATGAATAAGAAACGAGAGGCAGAGTTTCAGAAGCTCCGCAGAGACCTTGAAGAGGCCACTCTGCAGCATGAGGCCACTGCCGCCACACTCAGGAAAAAACAAGCCGACAGTGTGGCTGAACTTGGAGAGCAGATAGACAATCTGCAGAGGGTCAAGCAAAAACTGGAAAAGGAGAAAAGTGAACTTAGGCTGGAGTTGGATGATGTAGCCTCCAGCATGGAGCATATTGTGAAGTCCAAG[G/A]TGAATTGAATTGCTTGACTTTTTTAAAAGAACAACGAAATTACAATTCAAAATGGTCTAAATTAATGCAACACTTACTTAAACAGACTAATATGGAGAAAGTTAACAGAACCCTTGAAGATCAAATGAATGAATACCGTAACAAATGTGAGGAATATCAAAGGTCCCTCAATGATTTTACAACTCAGAAGGCAAAGCTTCAGGCAGAAAATGGTAAATCAAGCATGTTGTTTTTGTTCAACTTTAAATCATTGAGAGAAATACAAGAAAAGAGTATTTGATTGTTTCTTTCACTACATTAGATGAATTTTCAAGACAATTAGAAGAAAAGGAATCATTAGTCTCCCAGCTAACAAGGGGTAAGAATTCCTTCAGTCAACAATTGGAGGACCTAAAAAGGCAGTTAGATGAGGAAATTAAGGTAACATACACTTTTCCTATATTTCTACCACTGTTTGACAGTCTACAACAAGGTAATCCAATATTTTCTTTTTTCCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 1507 1943 29 37
ENSDART00000123064 None None 638 None 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Nonsense 1500 1936 31 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23586853)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24621642
GRCz11 2 24277293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AKTTGAAGAACTCATATGAGGAATCTATRGATCACCTGGAAACCATGAAG[A/T]GAGAGAACAAGATTCTGCAAGGTTTCTATTTTATACACSTTTCCAWAAAC
Long Flanking Sequence:
GTGGATGTGGAGAGATCTAACACTGCTGCTGCTTCTTTAGACAAGAAACAAAGACACTTTGATAAAGTAAGTGAAAGTATAGTACTTAACATGACCAAAACTGTTTTAACGGTTCAAATTTTCTACTGCAATCTTCTACTCTTAGATGTTAAAGATTGTTTATCAGCATTGGTTTTGGGGAGAATGGTTAATATTTTTCATCGCACAGTTTAGTGGAAAAGTGTTCAATATGTTATTCATATATTCTTCAAACATCATTTTAAAATCTTTAGTTTTAAGAGTCTATAATCACCCTTTTTCACACTATTAATTTGAATAATTTAACCTCATTTCAACATTTACAATCTTTCTTTCAGATCATATCTGAATGGAAGCAGAAGTATGAGGAGTCTCAGTGTGAACTGGAGAGCTCTCAGAAGGAAGCCAGATCTTTGAGCACAGAGTTGTTCAAGTTGAAGAACTCATATGAGGAATCTATGGATCACCTGGAAACCATGAAG[A/T]GAGAGAACAAGATTCTGCAAGGTTTCTATTTTATACACGTTTCCATAAACTCAGAAGCATGTTTTTATTTTTGTATTAATAGTCTCAATAGGCTATCCTAACCTAATTCTATTTATCATTTAGAGGAGATCTCCGATCTGACTGAACAGCTTGGCGAAGGTGGAAAGACAATACATGAGCTGGAGAAAGTCCGTAAGCAGCTGGAGCAAGAAAAAGCTGAGATACAGGCGGCTCTGGAAGAGGCTGAGGTAGGAGGGTGCCCACAAAATAAATGAAAAAAGAGCAGGTATGACATGAGGAAACTAATTATGTGTATTACAGGGATCTTTGGAGCATGAGGAGGGTAAAATCCTGAGAACGCAGCTCGAATTTAACCAAATAAAGGCAGACATTGAGCGCAAGCTGAGTGAGAAAGATGAGGAAATGGAACAGGTGAAGAGAAACCAACAGAGGACCATAGACACCCTGCAAAGTGCTTTGGAGTCTGAAACCCGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39821
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 1809 1943 33 37
ENSDART00000123064 None None 638 None 17
ENSDART00000123565 None None 242 None 8
ENSDART00000128784 Nonsense 1802 1936 35 39
ENSDART00000137560 None None 99 None 2
ENSDART00000141922 None None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23588105)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24620390
GRCz11 2 24276041
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGGAGCAGACCATTAAGGACCTGCAGCATCGCCTGGATGAAGCAGAA[C/T]AAATCGCTATGAAGGGAGGAAAGAAACAAGTCCAGAAACTGGAGGCCAGG
Long Flanking Sequence:
CAAATGATGATCTGAAGGAGAACACTGCCATTGTGGAGAGACGTAATGCTCTGCTTCAGGCTGAGCTTGAAGAGCTCAGGGCTGTTTTGGAGCAAACAGAGCGTGGACGCAAACTTGCTGAGCAGGAGCTCCTGGACGTCACTGAGAGAGTACAGCTTCTGCATTCTCAGGTAAAACACAGAGTCATCATGGATGTTGTTAAAATGATTATTTGCAACCCCTTTAACAAAAATTGACAACATTATCTGATACAGAACACCAGTCTCATAAATCAAAAGAAGAAGCTGGAGACGGATTTATCCCAGTTTCAGACAGAAGTGGAAGAGGCAGTGCAAGAATGCAGGAATGCTGAGGAAAAAGCCAAGAAGGCCATCACTGATGCTGCCATGATGGCGGAGGAGCTGAAGAAGGAGCAGGATACAAGTGCTCACCTGGAGAGGATGAAGAAGAACATGGAGCAGACCATTAAGGACCTGCAGCATCGCCTGGATGAAGCAGAA[C/T]AAATCGCTATGAAGGGAGGAAAGAAACAAGTCCAGAAACTGGAGGCCAGGGTGAGATCAATATAAAGTTTTTGGGACTCTAATAATTTTAGAAGACATAAACAAAGCATTGGCTAATGTACTTCTAATGGATCAATCCTAGGTCAGAGAGCTGGAATGCGAAGTTGAGGCCGAACAGAAGAGAAGCAGCGAATCTGTGAAGGGAATCCGTAAATATGAACGCCGCATCAAGGAACTTACTTATCAGGTGGGATTAGAAGATTTAGATGTCATGGAGCATTGAAGAAACCTGGTAAAAATCTAAATAAATCATGTACACAGAATTAATCTTTAGTTATGAATCTTAGACTGAAGAGGACCGTAAAAACATAGCCCGTCTTCAGGATTTGGTTGACAAGCTGCAACTAAAAGTCAAAGCTTACAAAAGAGCTGCAGAGGAATCTGTAAGTGCTGTTACAATTCAGGTACAATACTAGAAAGTGGTGTTGTCTAAATTACAAT
Associated Phenotype:
Not determined