Busch Lab

ZMP

SPESP1

Ensembl ID:
ENSDARG00000079773
Description:
sperm equatorial segment protein 1 [Source:HGNC Symbol;Acc:15570]
Human Orthologues:
AC027088.1, SPESP1
Human Descriptions:
NADPH oxidase 5 [Source:UniProtKB/Swiss-Prot;Acc:Q96PH1]
sperm equatorial segment protein 1 [Source:HGNC Symbol;Acc:15570]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24610 Essential Splice Site Available for shipment Available now
sa10707 Essential Splice Site Available for shipment Available now
sa9962 Nonsense Available for shipment Available now
sa19358 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114653 Essential Splice Site 91 749 3 18
Genomic Location (Zv9):
Chromosome 25 (position 8209211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7821735
GRCz11 25 7945827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAACAGGTAGGTGTGTGAATGGAAAAATGGATGGATGGATGGATGAATG[G/A]TTGTATGGACGAACGGAAGGACAGACGGTAGTAGGGACGGATAGACGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114653 Essential Splice Site 382 749 10 18
Genomic Location (Zv9):
Chromosome 25 (position 8201140)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7813664
GRCz11 25 7937756
KASP Assay ID:
2261-9385.1 (used for ordering genotyping assays)
KASP Sequence:
TAAACCTGGAAAATACTGTTTGAAGATTAATTCAAAAYGGTTTTCTGTGC[A/T]GGTCTTCTACTGGTCTCATCTGTCCTACATCTGGGTTTSGGCTCTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9962
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114653 Nonsense 628 749 16 18
ENSDART00000114653 Nonsense 628 749 16 18
Genomic Location (Zv9):
Chromosome 25 (position 8192244)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7804768
GRCz11 25 7928860
KASP Assay ID:
554-6225.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTTTTTGCMCTGCTGCAGGTGGACTTTATTTGGATCAACCGTGATCAG[A/T]AGTCCTTCGAATGGTTTGTGAGTCTTTTGACCAAACTGGAGATGGACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19358
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114653 Nonsense 628 749 16 18
ENSDART00000114653 Nonsense 628 749 16 18
Genomic Location (Zv9):
Chromosome 25 (position 8192244)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7804768
GRCz11 25 7928860
KASP Assay ID:
554-6225.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTTGCCCTGCTGCAGGTGGACTTTATTTGGATCAACCGTGATCAG[A/T]AGTCCTTCGAATGGTTTGTGAGTCTTTTGACCAAACTGGAGATGGACCAG
Associated Phenotype:
Not determined