Busch Lab

ZMP

si:dkey-202m9.3

Ensembl ID:
ENSDARG00000079752
ZFIN ID:
ZDB-GENE-041111-303
Human Orthologues:
COL6A5, COL6A6
Human Descriptions:
collagen, type VI, alpha 5 [Source:HGNC Symbol;Acc:26674]
collagen, type VI, alpha 6 [Source:HGNC Symbol;Acc:27023]
Mouse Orthologues:
AC119951.1, Col6a4, Col6a6
Mouse Descriptions:
collagen alpha-5(VI) chain precursor [Source:RefSeq peptide;Acc:NP_001161395]
collagen, type VI, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1915803]
collagen, type VI, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:2444259]

Alleles

There are 14 alleles of this gene:

Allele Name Consequence Status Availability
sa9393 Nonsense Mutation detected in F1 DNA Not yet available
sa36205 Nonsense Mutation detected in F1 DNA Not yet available
sa17668 Nonsense Available for shipment Available now
sa36207 Nonsense Mutation detected in F1 DNA Not yet available
sa39119 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44856 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22900 Essential Splice Site Available for shipment Available now
sa565 Nonsense Available for shipment Available now
sa36208 Splice Site Mutation detected in F1 DNA Not yet available
sa14196 Nonsense Available for shipment Available now
sa12050 Essential Splice Site Available for shipment Available now
sa5895 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 88 2543 1 39
Genomic Location (Zv9):
Chromosome 16 (position 38076959)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36717442
GRCz11 16 36671326
KASP Assay ID:
2261-0054.1 (used for ordering genotyping assays)
KASP Sequence:
GAGCTGTTYAGGAAAATAGACAACCTTCCATACCGAACCGGAGGCACGTA[T/A]ATGGGAAAAGCCATGAATTTYCTAAAGGACAATTACTTCACAAGTGCWGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36205
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 191 2543 1 39
Genomic Location (Zv9):
Chromosome 16 (position 38077267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36717750
GRCz11 16 36671634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAGCATTGCAAGGACTGACGACCACTATGAAGGAGACAGTGTGTGTCT[T/G]AATGAGGGATCAGGGGAAAGGTAAAGTACATTTTGCAACCCTGTTTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 219 2543 2 39
Genomic Location (Zv9):
Chromosome 16 (position 38081187)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36721670
GRCz11 16 36675554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTACTGATGTAWTTGTGTTGGTGGACAGTACAGCTCAGGGGGAAAYA[C/T]AGCAAATAAGGGAACTTCTCAACCGACTGCTTGTGCAGCTCAATGTGGGY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28703
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 382 2543 2 39
Genomic Location (Zv9):
Chromosome 16 (position 38081680)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36722163
GRCz11 16 36676047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGTCACAAAAAGAATTCAGGAGAAAGAGGTTTTCAATGTTACAGGAG[G/C]TTGGTTTACTTTTAACTACAAATAACACAGACACACAAGACTATATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 599 2543 4 39
Genomic Location (Zv9):
Chromosome 16 (position 38087158)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36727641
GRCz11 16 36681525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTAATCCTTACCTTCAGGATGTGTGAACACAGAGGAAGCAGACATTTA[T/A]TTCCTGTTGGACAACTCTGGCAGCACTCGCGCCGACTTTGAAGATGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 775 2543 4 39
Genomic Location (Zv9):
Chromosome 16 (position 38087686)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36728169
GRCz11 16 36682053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAATGTTCTCAAGCGAGAAATTGTCACAGATATTTGCTCTCAAGAGGG[T/C]AAGAGAGTTATCAAACATATACAGCAACATATTGTTGTTTCTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44856
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 962 2543 5 39
Genomic Location (Zv9):
Chromosome 16 (position 38090673)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36731156
GRCz11 16 36685040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATCGACAAAAACCTACAATTCAAGCTCTGCAGCTCTCACCCTGGCGG[T/A]GAGTCAGTTTACCATGAAAGCCATTTTTGTTAGCAAATTACAGTTGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22900
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 1672 2543 17 39
Genomic Location (Zv9):
Chromosome 16 (position 38106298)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36746781
GRCz11 16 36700665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAAGCTCAGGAAGCCCAGGACAACGAGGCCTGAGAGGAGATCCGG[T/G]TAGTAGAATTCAGCTGCAAATAAATCTCTTAAAGGGATAGTTCACCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 2034 2543 32 39
Genomic Location (Zv9):
Chromosome 16 (position 38113026)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36753509
GRCz11 16 36707393
KASP Assay ID:
554-0475.1 (used for ordering genotyping assays)
KASP Sequence:
GAGTGCGAAAAGGCRTCCTGATGAGGAAGGTTGCCATTTTCCTYACTGCT[G/T]GAGAATCTCAAGATTCGATATCTCTCACCACTGCCATTCTAGAGTACAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36208
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Splice Site None 2543 None 39
Genomic Location (Zv9):
Chromosome 16 (position 38114650)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755133
GRCz11 16 36709017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCCAGAACTTTTTCCACCTATTTATTGTATGATAACATCTTTTCACA[T/A]CCAAGATCCCTGCAGACCAGCTAGAGAATGTGAGGGCACCAACCTGCCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4675
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 2178 2543 34 39
Genomic Location (Zv9):
Chromosome 16 (position 38114874)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755357
GRCz11 16 36709241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGTCAAYCCACCAGGKCYGACAGACAGGCCAGAGTRGCTCTCTACCAG[C/T]AGACGTCTACCTATAGTGACCCCCAGCCTGCACAMGAGATATTCAGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14196
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 2294 2543 34 39
Genomic Location (Zv9):
Chromosome 16 (position 38115224)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755707
GRCz11 16 36709591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGTGGGAGACTCCATCGCCTCTAGTCAGGTGGAGGAGCTTGCCAGCTA[T/A]CCTTTAGWACAGCACATCATTCACCTGGGCCACTTGAAACATGGAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12050
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 2327 2543 34 39
Genomic Location (Zv9):
Chromosome 16 (position 38115323)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755806
GRCz11 16 36709690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGAGTACACACAACGCTTCATGAGGACTTTCTTCCATATACTGAGCAG[T/C]AAGGAGTKTTTCATGTTAATGCTGATTTGAWTTGGGTCAAAAGAATTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5895
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 2484 2543 38 39
Genomic Location (Zv9):
Chromosome 16 (position 38123962)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36764445
GRCz11 16 36718329
KASP Assay ID:
554-3911.1 (used for ordering genotyping assays)
KASP Sequence:
GATCCTGAAGTAATCCCACAGACACAAGTTGAAACGGCTTTATTTAATGG[T/A]AAGGATTGAGCCACATTTGTAACATTTTCTTGCCTTGTCTGGCTTTTGCT
Associated Phenotype:
Not determined