Busch Lab

ZMP

zgc:171837

Ensembl ID:
ENSDARG00000079749
ZFIN ID:
ZDB-GENE-080204-99
Description:
zinc finger protein 341 [Source:RefSeq peptide;Acc:NP_001108045]
Human Orthologue:
ZNF341
Human Description:
zinc finger protein 341 [Source:HGNC Symbol;Acc:15992]
Mouse Orthologue:
Zfp341
Mouse Description:
zinc finger protein 341 Gene [Source:MGI Symbol;Acc:MGI:2682937]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24831 Nonsense Available for shipment Available now
sa44435 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39524 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24831
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Nonsense 196 796 5 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 35817)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43606646
GRCz11 23 43499010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTCTCACAGGTATCATCTAGCAACAGCAGTTCAGTGGTGCAGGTGTA[C/A]AGCGCACTGCCCCCGCTGACCGGAGCAGGAACTGCAGAGGTGCCCGCGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30529
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Essential Splice Site 284 796 7 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 40938)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43611767
GRCz11 23 43504131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCATGACAAAGCAGACTTCTGACTGATTTTTCTTATATATGTTATTCCA[G/T]CAGGCCAAGCCAAAGGTAAAGCCCAGAAACTCAAGTGCAATTACTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44435
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Essential Splice Site 315 796 7 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 41033)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43611862
GRCz11 23 43504226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAAAAAGTGTTTACCAAGAACTTTGACCTCCAGCAGCACATCAGAAG[G/A]TAAACCAGCAGATTTAATATCATGTTGTTTTTGTTGTTTATATTCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39524
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Essential Splice Site 650 796 15 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 54071)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43624900
GRCz11 23 43517264
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTTTTTTCTGAATGTGGCTGTGTTAATGGTGTGCTGTTTGTCTGC[A/C]GGTATAAAGCCGTTCAAGTGTCAGGTGTGTCAGAAGTCGTTCAGTCGGCG
Associated Phenotype:
Not determined