Busch Lab

ZMP

kif13ba

Ensembl ID:
ENSDARG00000079731
ZFIN ID:
ZDB-GENE-070521-1
Human Orthologue:
KIF13B
Human Description:
kinesin family member 13B [Source:HGNC Symbol;Acc:14405]
Mouse Orthologue:
Kif13b
Mouse Description:
kinesin family member 13B Gene [Source:MGI Symbol;Acc:MGI:1098265]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16494 Nonsense Available for shipment Available now
sa23032 Essential Splice Site Available for shipment Available now
sa36370 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2943
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Splice Site, Nonsense 375 1761 10 40
Genomic Location (Zv9):
Chromosome 17 (position 16090264)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16241092
GRCz11 17 16249025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGACGGTCACCTGGGAAGAGAAACTTCGCAAAACTGAGGAAATTGCA[C/T]AGGTAACCGCAACTGTAATTTTGACNNNNTGTTTTGTCTGGATTGTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Nonsense 685 1761 16 40
Genomic Location (Zv9):
Chromosome 17 (position 16097443)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16248271
GRCz11 17 16256204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTCATYGCYGAAGAGCTGGACAAGAGAACGRAGTACAGAGTTACTCTA[C/T]AGATCCCYGCCGCAAACCTCAAYGCTAACAGAAAGGTAGACATGTTTTRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23032
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Essential Splice Site 696 1761 16 40
Genomic Location (Zv9):
Chromosome 17 (position 16097480)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16248308
GRCz11 17 16256241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGTTACTCTACAGATCCCTGCCGCAAACCTCAACGCTAACAGAAAGG[T/C]AGACATGTTTTGCACTAGCACACACAGCATCTATAGCATTGTTGGTGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28829
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Nonsense 750 1761 18 40
Genomic Location (Zv9):
Chromosome 17 (position 16100553)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16251381
GRCz11 17 16259314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGTATGTGTGTGCTCTATATCTCCATCTCATAGGTGATGCGCTCATA[C/A]TTCAAGAGAGCCGACCCTTTCTTCGATGAGCAGGTCAATCACAGTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36370
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Nonsense 997 1761 23 40
Genomic Location (Zv9):
Chromosome 17 (position 16106061)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16256889
GRCz11 17 16264822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTAACACAGGGATTTTGTGTGTCTTTGTTTCTCAGGGTCAGTCTCGG[C/T]GAGTTCAGGTGGAGGTGCGTTCAGTTCAAGATTCGGGCACAATGCCATTA
Associated Phenotype:
Not determined