Busch Lab

ZMP

fbn2a

Ensembl ID:
ENSDARG00000079729
ZFIN ID:
ZDB-GENE-090112-4
Description:
Fibrillin 4 [Source:UniProtKB/TrEMBL;Acc:B6D7H3]
Human Orthologue:
FBN3
Human Description:
fibrillin 3 [Source:HGNC Symbol;Acc:18794]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41616 Nonsense Mutation detected in F1 DNA Not yet available
sa34874 Nonsense Mutation detected in F1 DNA Not yet available
sa41617 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41616
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Nonsense 55 717 3 17
Genomic Location (Zv9):
Chromosome 10 (position 16818829)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16315524
GRCz11 10 16339921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTCAGATGTAAACGAGTGTTCGGAGGAGCCTGGGATCTGCACATA[T/A]GGGACCTGCTTCAACAGTCTGGGCAGCTTTGAGTGTGTGTGTAAACCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34874
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Nonsense 262 717 8 17
Genomic Location (Zv9):
Chromosome 10 (position 16828435)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16325130
GRCz11 10 16330315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAATCCTCTGCTCTGTGCATTTCGCTGCATCAACACTTTCGGGAGTTAT[G/T]AATGCAGCTGTCCATCTGGTTACACACTGAGAGAGGATGGACGCATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41617
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Essential Splice Site 279 717 8 17
Genomic Location (Zv9):
Chromosome 10 (position 16828490)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16325185
GRCz11 10 16330260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTCCATCTGGTTACACACTGAGAGAGGATGGACGCATGTGTCAAG[G/A]TATGAAATATCATTAATAATCAATGATTTTAACAATATAACTTTTCTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3755
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Nonsense 291 717 9 17
Genomic Location (Zv9):
Chromosome 10 (position 16829828)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16326523
GRCz11 10 16328922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCCTTTATRTACAGATGTGGACGAGTGTGCAGAAGATCTTCATAACTG[T/A]GACTCCAGAGGAATGGAATGTAGCAACCTAATTGGCACATTTATGTGTGT
Associated Phenotype:
Not determined