Busch Lab

ZMP

sepp1b

Ensembl ID:
ENSDARG00000079727
ZFIN ID:
ZDB-GENE-030311-2
Description:
Sepp1b protein [Source:UniProtKB/TrEMBL;Acc:B5DDI2]
Human Orthologue:
SEPP1
Human Description:
selenoprotein P, plasma, 1 [Source:HGNC Symbol;Acc:10751]
Mouse Orthologue:
Sepp1
Mouse Description:
selenoprotein P, plasma, 1 Gene [Source:MGI Symbol;Acc:MGI:894288]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18468 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18468
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115071 Essential Splice Site 144 360 3 5

The following transcripts of ENSDARG00000079727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27546888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27743084
GRCz11 2 27398718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTGGRARATCCTGGAGGGAGACAAGGATGATTTCTTRGTGTATGACAG[G/A]TATGASTGAAACACACCAATAAGACAAGTTTGACATGACTCTTATGTTCA
Long Flanking Sequence:
TTGGCCCTTATACATTTGAAATTTAAACAAATTTAAAATCACGTAAAACTTTTCAAATTAATTGTTCATTCATTTTACTTTTGGCTTAGCCCCTATTAATCTGGGGTCGCTACAGCAGAATGAACTGCCAACTTATGTAGCATATGTTTTAGGCAGCGGATGCCCTTCCAGCTGCAACCCATCACTGAGAAAATCAAATGAATTAGATATATCATTTCTCATGTGGTAACTGCTAAACTTCTCAGCCATAAAGTCTCTTTATCCTCTCTTCCTCTTTGGTTGTGAAGGCTGGGAGACCTGCGTGACAAGCTGGCTAATGGAGGACTGACTAACATTTCATTCATGGTTGTGAATGAGCAGGACTCTCAGTCCAGAGCCATGTACTGGGAGCTGAAAAGGAGGACAGCTCAGGACATCCCGGTGTACCAGCAGAGCCCACTGCAAAATGACGTCTGGGAGATCCTGGAGGGAGACAAGGATGATTTCTTAGTGTATGACAG[G/A]TATGAGTGAAACACACCAATAAGACAAGTTTGACATGACTCTTATGTTCAAGTGAGGGATCTCCTCCAAACATAGTAAACCTGAGCTTCTGTGTTCACACAACTAGCAAAAACAAGTAAAAATACCAGATTACTGTTGTGTTTGCCATAAGGAAAAATGCTAAACGCATGTGGGCATTTTGTCTCTCTTTCTTTTTACTGAACTATTCTCCAGTAAGGAAAACAGGAGACTCGTTAGAAACAACCAGATGGCCAACCAAAAAGTAACTCCGGGTTATACAAAGATTGGCCAACTCAAAATGCATACATTCCTGATATGCGAGTCCCATTTCACACTCAATACCTTACAATTGTATGTTATAAATAAAGCACTGCAACATACTAAAGAGAGAGATGGACTCAGAAAGTCACGTACCAGTTTAATGATTATTTGATCAGCTGTAGTTAGAAATGACGCTGTTTTCATGTATATCAGTGTTGTGTAAAGTAACTTTTGAAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25821
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115071 Nonsense 288 360 5 5

The following transcripts of ENSDARG00000079727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27548932)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27745128
GRCz11 2 27400762
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATTTTATTTTATATAATGTTTTTTTTTTTTGTAAATATATGGAGCTG[C/A]TCTTGTGTCAGAACTTCATATTTACCTCAGAGGGGGGTATTCGGTTGTCT
Long Flanking Sequence:
ACCTTTCACATTGTCCTGCCATTCAGTTTTCTTCACTACCCTTATATAGAAGCTGCCATCAGGGCTACATATCACAAAAACATGTGCAACTGCTCAGTGAGTGACAACACCCTCAGAAAAAAAGTGTCATATTTATGAAATGCTTGCATGTGTTCACTTATTCTATCTCTCCTTTAGCTAAATGCCAACTTTTCCATATCAGAAAGCTCTGACAGCACCAAAAATGAGCCCGCAGGAGAAAACAACCAGCGGCCCAACAGTACAGAGCCAGTAACTGCTGCTCATCATCATCATCATCAACAACATGAGCCTCATCATCATCATAATCCATATCCAAATAACCATAAAAAATCAGGCGATTCAGATGTGACCGGGAAACCAAAGGAGCCAACCCATCATTCTCATCAAGAACATGTTCACAACCACAGATTTTACACAGTTTTTAGTTTTATTATTTTATTTTATATAATGTTTTTTTTTTTTGTAAATATATGGAGCTG[C/A]TCTTGTGTCAGAACTTCATATTTACCTCAGAGGGGGGTATTCGGTTGTCTTCAGTGTATTTTTGTTCTTAATGAAGTGTACACTTTAAACCTGAGACAGGGGTCTGTATGCGGATGCTGAACACAGGAGTCATTTATTTACACTAAACTTCTGATTTCCCCCCTTTTTGGGAAAATGTGATTGTGCTGAACTAAGTGGTTGCTTGGATTATTATGTTAACAGCCTTTTCTTTACTAATATGTTGTTTGATATGTTAAGTTAATGTAAACAGCCAAAAATGGTGTAAGATATGCAAAGAGCTGTAAAATAAATACATACATGTTACTAAATATTAATTAAAAAACTATGTAATGTCTTTTCTGTTTTTTTTTTAACTAAAAAGGATAGTTTACATGGATAGACTTTACATTTTCATGCCATCCTTGAAAAAATATATGAGAGTTTTTCTTCTTTTGAGCACTAAATAATGTTTTGAACAATGCTAAAAACTGGTAGTCATT
Associated Phenotype:
Not determined