Busch Lab

ZMP

NP_001082801.1

Ensembl ID:
ENSDARG00000079721
Description:
hypothetical protein LOC325787 [Source:RefSeq peptide;Acc:NP_001082801]
Human Orthologue:
ZC3H7B
Human Description:
zinc finger CCCH-type containing 7B [Source:HGNC Symbol;Acc:30869]
Mouse Orthologue:
Zc3h7b
Mouse Description:
zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25981 Nonsense Mutation detected in F1 DNA Not yet available
sa5725 Nonsense F2 line generated Not yet available
sa2113 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa25981
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Nonsense 6 952 2 25
Genomic Location (Zv9):
Chromosome 3 (position 5059738)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4582839
GRCz11 3 4493129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTTTGTTTTTCAGCTGTGTGATGGTCAAACATGAGCGCTGAGCGG[C/T]AGAAACGGCAGGAGAAGATTCGGAGAGCGCTGAGCTTCATCAAGTATGAC
Long Flanking Sequence:
TCTAAAGACAGTCAGTTCCCCTCAGAGATTCATATAAGCTCTTACTCCAGCTGTATTGTCTTTTGTTTGACATCTCAACCAGATTTTCAACTTAAGTTTGTGGTTCATCTTTACATTCCTACTGCTTTATAAATAAACTGCTCCTTCATGGGAAAATAGTTTACACCCTTGAATGCATTCCCTGCTGAAAATGTTGATTGGCTGATTTGAACTGGTTAACCAGGCTGGTTTAGAAGTGTTTAGGCATTTTTCAGCCTGGCTAAGCTAATTTTAGCTGGTCATTCCAGCCTGGAACTGGCCAAAACACCAGCCTGGTTTTAAGTTTTATTTTAGGGTTATTATATTTTATGGTCTGTGAACTTGTGAATGTACTTGTGAACCCAGTGCACTGAAGGCATGTGAGTGTGTTTGAGACCGAACAGCTGGTAAACATGAACGTCTGCTGATGTGTGTGTGTTTGTTTTTCAGCTGTGTGATGGTCAAACATGAGCGCTGAGCGG[C/T]AGAAACGGCAGGAGAAGATTCGGAGAGCGCTGAGCTTCATCAAGTATGACAGATAATAAATACTGCACTATTTTACTGCACAGAGACCTGCTTTACCCTTCTGTGACTGTTTTTTTATCTGACTTTTCTGATATGTGGTACACAAAGCTTTTGACTTAGAATTTACAAAACAATTCAACAATCCCATATATAGTGTAAAAGAATATAAATAAACTAAATAAAGGAGCACACAAAGACATTCTAATAATACCCTAAATGTTTCTTGTCAGCCTAAAAAATAGTTTGCCACTCAGGTCTATGGGAAACACAGTCTCTGAATATGCTTCATATGTCTTTGATTGTTGACATCATACATTCAGTCAGTCGCTATCGTGGTTTGGCTGTAATTTATGCATAACTTGGTTAATTGAGTCAAGTTTGTAATTGGATAAATGTATGAATAGATTTTATAGAGGTAAACAAACTCTTTGAGGAGCAGTGATCTATCATTTTAAGCATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25980
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Essential Splice Site 345 952 10 25
Genomic Location (Zv9):
Chromosome 3 (position 5043201)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4566302
GRCz11 3 4476592
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTGGGAGGAGAAGGACTGGACTCGCTCTCTCACTTCAGCCTGTCAGG[T/C]CTGTGTATTCACTGAGACTCAGTTTCATTCACTGCCTATAAGCAGACTCT
Long Flanking Sequence:
TATTAAATGTTTTCTTTTATATTCGGTATTCTCTGTCTTTAGCTCTCCTATGTACAGCACTTTAGTTGTTTTTAAATGTGCTTTAAAGATAAGTATTGTATTGTATTTTAGATATTATTCTGGGTGTAAATGTGCTTTAAAGATAAGTATTGTATTGTATTTTAGATATTATTCTGGGTGTGAAGGGGCCTTAACTAATAATGAGGCTGTATATTAGTGATGTGCTCTGCAGCTACTCATTCATGAATTCTCCTCTGTCAGACTCGAGTTGTTCCTGCTGGTCTGGCGTGTTTCTCCTCTTCATCTCCTGGTCTTCCTCCTGCGTTCTTCTCATCTGCTGGCAGTGAGTTAAACGCTCTGGACTCCTTCATTTCCCCTGAGCCGGACTCCTGCAGTGCTGATTTGGATGCTCTGGACTCCATCTGTCCGTCCGCTGGCTCAGGGTCTGTGCAGCTGGGAGGAGAAGGACTGGACTCGCTCTCTCACTTCAGCCTGTCAGG[T/C]CTGTGTATTCACTGAGACTCAGTTTCATTCACTGCCTATAAGCAGACTCTTGCCTTTAAGGCAATTCATTTCACTTGGCCCCGATCTTTGAAACACTGCTCAGGCATTCTGTTTGAATTGGGAAACACCAAATTCTCCAATATTGCTGGCCAAGCTTACGGTTAATTTTCATATTAGGAATCACCAATGAAATTAAACCACAACTGTCTCTTTAGTTTCATTTCCAAATGAGTCACACAAAATCTCCAGAAACTCATATCTGGTCCGTGCCCCTTCCCTGGAGAATCCTCTCAATATAGCAATCACTCATTGGCTCCTGTACTAGAAGGCGGGGCTTCATTCACCATATTGACCATTACACTTTTCCCCATTCAATGGAAGACAATTAACATATGTTGTGTATTCTGTAGTCTTTGCTATAAGTGAAGGTGTGCTGATGTTTAATCTTCATTATTTCTCTGTCAGATGTGAAAGCGTGTCGTAGTTTTCTGCCGTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5725
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Nonsense 715 952 19 25
ENSDART00000111562 Nonsense 715 952 19 25
Genomic Location (Zv9):
Chromosome 3 (position 5030637)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4553738
GRCz11 3 4464028
KASP Assay ID:
554-3096.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGAACACTCNNGACCCCTCTCACTCTCTCCACCTTTCTCTCTTCAGCT[G/A]GACCAAAGMGAGGAGGGTTTTACTGGTCAAGTCTCACGAGAGGAAGAART
Long Flanking Sequence:
ACTGCTGCATTAAAAACTTCATCTTAAAAACATGAAGTGCAGATGATCCAATGATCATTGCAAATGTGAAGAATCATAAATGTATATAAGCAATAGGTTTATTATTGAAAAATCTAAATGTTATATAGGAGAAAAACTGTGTACAACTTACTGCCATTAGCTAAATTAGTCTGCTTGTTTCTGCATATCCAGAGGTTCACATAATCTTGGATACGGCCCGTATTAAGAGCCAAATGTAGATGAGTCAGATAATATAATCATGTAATCCATCAAAAAATAACAAAAATAATATCCATCAAAAAATAAAAATAGTAATCTGATTATGAGTATTTTAGAAAGTATTTTACTGTAATTACAAGTACTTTATTTTTGTAATCTCATTACATAACTGAGATTAAATATTATATAATTTGTTACTATTCAGCTCAGTGAACACACACACACACAATGTGTGAACACTCTCGACCCCTCTCACTCTCTCCACCTTTCTCTCTTCAGCT[G/A]GACCAAAGAGAGGAGGGTTTTACTGGTCAAGTCTCACGAGAGGAAGAAGTGGGTCTCTGTGCGACCTTTGCCCTTTGCCAAGACATATCCTCAACAATACGACGTGTGTGAAAACAGTGTATTTTCATTTCATTCTCATACAGGAAATGTTTTTGTTTTGAGTGTAATTCGCACATCCTGTCCTATAAAGCAGACACATCTCACCTTATTAAGGTTAACGGCTAACTGATTAATTGGTCTTTCATTTAAATGACGATCAGAAGATTTTGTGGAAAATAACATCGAAATTGACCCCTTTGATGGTTATTTAAAATCCAAGACACATCTAGTTATTAGTTGTTTATTATATGATTAAAAAAGCAATAACTCATACACCAACAATTAAAAAATATAAATCTTAATATTGTATGCTACTATAAAAATATTGGTATTGTTTAATCCACATTTTGAATTTCTGGACAAATTTACAAGGTTTTAATCTACTTTCGATGGTGACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2113
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Nonsense 715 952 19 25
ENSDART00000111562 Nonsense 715 952 19 25
Genomic Location (Zv9):
Chromosome 3 (position 5030637)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4553738
GRCz11 3 4464028
KASP Assay ID:
554-3096.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGAACACTCNNGACCCCTCTCACTCTCTCCACCTTTCTCTCTTCAGCT[G/A]GACCAAAGAGAGGAGGGTTTTACTGGTCAAGTCTCACGAGAGGAAGAART
Long Flanking Sequence:
ACTGCTGCATTAAAAACTTCATCTTAAAAACATGAAGTGCAGATGATCCAATGATCATTGCAAATGTGAAGAATCATAAATGTATATAAGCAATAGGTTTATTATTGAAAAATCTAAATGTTATATAGGAGAAAAACTGTGTACAACTTACTGCCATTAGCTAAATTAGTCTGCTTGTTTCTGCATATCCAGAGGTTCACATAATCTTGGATACGGCCCGTATTAAGAGCCAAATGTAGATGAGTCAGATAATATAATCATGTAATCCATCAAAAAATAACAAAAATAATATCCATCAAAAAATAAAAATAGTAATCTGATTATGAGTATTTTAGAAAGTATTTTACTGTAATTACAAGTACTTTATTTTTGTAATCTCATTACATAACTGAGATTAAATATTATATAATTTGTTACTATTCAGCTCAGTGAACACACACACACACAATGTGTGAACACTCTCGACCCCTCTCACTCTCTCCACCTTTCTCTCTTCAGCT[G/A]GACCAAAGAGAGGAGGGTTTTACTGGTCAAGTCTCACGAGAGGAAGAAGTGGGTCTCTGTGCGACCTTTGCCCTTTGCCAAGACATATCCTCAACAATACGACGTGTGTGAAAACAGTGTATTTTCATTTCATTCTCATACAGGAAATGTTTTTGTTTTGAGTGTAATTCGCACATCCTGTCCTATAAAGCAGACACATCTCACCTTATTAAGGTTAACGGCTAACTGATTAATTGGTCTTTCATTTAAATGACGATCAGAAGATTTTGTGGAAAATAACATCGAAATTGACCCCTTTGATGGTTATTTAAAATCCAAGACACATCTAGTTATTAGTTGTTTATTATATGATTAAAAAAGCAATAACTCATACACCAACAATTAAAAAATATAAATCTTAATATTGTATGCTACTATAAAAATATTGGTATTGTTTAATCCACATTTTGAATTTCTGGACAAATTTACAAGGTTTTAATCTACTTTCGATGGTGACTGCA
Associated Phenotype:
Not determined