Busch Lab

ZMP

sin3aa

Ensembl ID:
ENSDARG00000079716
ZFIN ID:
ZDB-GENE-070620-3
Description:
transcriptional co-repressor Sin3A [Source:RefSeq peptide;Acc:NP_001091650]
Human Orthologue:
SIN3A
Human Description:
SIN3 homolog A, transcription regulator (yeast) [Source:HGNC Symbol;Acc:19353]
Mouse Orthologue:
Sin3a
Mouse Description:
transcriptional regulator, SIN3A (yeast) Gene [Source:MGI Symbol;Acc:MGI:107157]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17441 Essential Splice Site Available for shipment Available now
sa37997 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17441
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083539 Essential Splice Site 60 1276 2 21
ENSDART00000138782 Essential Splice Site 60 95 2 3
Genomic Location (Zv9):
Chromosome 25 (position 6736481)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6255923
GRCz11 25 6383325
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
SCATGCAGCCCACTCCAGGAATACAGTACCCGCTTCCTCAAGCATACCAG[G/A]TACAGACACATATACCTATTTGGCCCCAANTATACTCRCAGTGAAGTCCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8053
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083539 Essential Splice Site 1103 1276 18 21
ENSDART00000138782 None None 95 None 3
Genomic Location (Zv9):
Chromosome 25 (position 6710097)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6229539
GRCz11 25 6356941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGYTGGACACAGAGGAAGAAAACTCAGATGGGCCGATGGAGATCGAGG[T/C]GAGCGAATAGTTACTTAAAGGGSACCTATGGTGAAAAATGCACTTTTNNNNNNNNNNNNNNNNNCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37997
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083539 Essential Splice Site 1135 1276 19 21
ENSDART00000138782 None None 95 None 3
Genomic Location (Zv9):
Chromosome 25 (position 6707584)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6227026
GRCz11 25 6354428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGACCTGAAGGATCATCTCTCCCAGAAGCCTGTGTTTCTGCCCAGG[T/C]GAGTCCAGCCAGGCGAGTCTCGCCGTTTCTACGTGCAACACACACTTTGA
Associated Phenotype:
Not determined