Busch Lab

ZMP

si:dkey-18p12.4

Ensembl ID:
ENSDARG00000079703
ZFIN ID:
ZDB-GENE-070912-408
Description:
hypothetical protein LOC794946 [Source:RefSeq peptide;Acc:NP_001116179]
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34673 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34673
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112827 Nonsense 299 435 11 11

The following transcripts of ENSDARG00000079703 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31425395)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30581341
GRCz11 9 30392087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCTAAAAAATATACCGGTCTCGATAACTGGGAAGGATTTCAAAGG[A/T]AGAAATGTAGGTTTGATGGCTGGGCGTGTGTTCAAGCTAAAGAGGGTTAC
Associated Phenotype:
Not determined