Busch Lab

ZMP

LOC559521

Ensembl ID:
ENSDARG00000079700
Human Orthologue:
B3GALT1
Human Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 [Source:HGNC Symbol;Acc:916]
Mouse Orthologue:
B3galt1
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40638 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40638
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113730 Nonsense 164 328 1 1
Genomic Location (Zv9):
Chromosome 6 (position 10051703)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9905510
GRCz11 6 10141049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGATTCCTATCACAATTTGACTCTGAAGACTCTCATGGGAATGCGATG[G/A]GTGTCTTTGTTTTGCCCCAACGCGCAGTACGTCATGAAAACCGACAGTGA
Associated Phenotype:
Not determined