Busch Lab

ZMP

rnf10

Ensembl ID:
ENSDARG00000079687
ZFIN ID:
ZDB-GENE-030131-2969
Description:
RING finger protein 10 [Source:RefSeq peptide;Acc:NP_001116727]
Human Orthologue:
RNF10
Human Description:
ring finger protein 10 [Source:HGNC Symbol;Acc:10055]
Mouse Orthologue:
Rnf10
Mouse Description:
ring finger protein 10 Gene [Source:MGI Symbol;Acc:MGI:1859162]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18120 Nonsense Available for shipment Available now
sa18452 Essential Splice Site Available for shipment Available now
sa14731 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18120
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108518 Nonsense 403 778 8 17
ENSDART00000133124 None None 156 None 5
Genomic Location (Zv9):
Chromosome 8 (position 43305283)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41258855
GRCz11 8 41266488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCAGGTTCTGTTGATGGGGTGGACATGAGGAAACTCTCTCTGTCTGAA[C/T]AATCCTCTCCAGAGGTGACTGTGGTCAATAACCTCACAAACTCGAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18452
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108518 Essential Splice Site 568 778 11 17
ENSDART00000133124 None None 156 None 5
Genomic Location (Zv9):
Chromosome 8 (position 43303669)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41257241
GRCz11 8 41264874
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATCTTCAGCCACCCATTCTCTCGAAAGAAACATTGGACAGTTTTGCAG[G/A]TACATCAGTGTAAAAGCATCTGCTGTATTAYGCACYATAAGATACATGAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108518 Nonsense 735 778 16 17
ENSDART00000133124 Nonsense 113 156 4 5
Genomic Location (Zv9):
Chromosome 8 (position 43301784)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41255356
GRCz11 8 41262989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCGGGTCCCTGTACCCAGTTTCCAGAACTCCTTYAGTCAGGCTCTGGGA[C/T]AGGCTCTATCAAAGCTGGACAATGGAAATCAAACCCCAGCCCCAGCTTTA
Associated Phenotype:
Not determined