Busch Lab

ZMP

CCDC46 (1 of 3)

Ensembl ID:
ENSDARG00000079679
Description:
coiled-coil domain containing 46 [Source:HGNC Symbol;Acc:28514]
Human Orthologue:
CCDC46
Human Description:
coiled-coil domain containing 46 [Source:HGNC Symbol;Acc:28514]
Mouse Orthologue:
Ccdc46
Mouse Description:
coiled-coil domain containing 46 Gene [Source:MGI Symbol;Acc:MGI:1923673]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13621 Nonsense Available for shipment Available now
sa12279 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13621
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113030 Nonsense 15 331 1 9
Genomic Location (Zv9):
Chromosome 3 (position 56418623)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55597644
GRCz11 3 55849253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTCCAGATGGAGAAAGTAGAGGCTGATCTGATTCGCTCTAAATCTCTA[C/T]GAGAAAAGCAGTGTAAGGAGTTCMGTCAYCAGTTGGAGGAGCTCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113030 Essential Splice Site 275 331 6 9
Genomic Location (Zv9):
Chromosome 3 (position 56542133)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55474090
GRCz11 3 55725699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCTGTTGAGAAGAAGCTGATGAACCGCGAGCTGGAATACCAGGAGCAG[G/A]TAAAGTTACAAANNNNNNNNATCCCAGTGCCACTGCCCCTGRAGGACCAGGAAGAAGC
Associated Phenotype:
Not determined