Busch Lab

ZMP

si:dkey-108c13.1

Ensembl ID:
ENSDARG00000079671
ZFIN ID:
ZDB-GENE-070705-280
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WV09]
Human Orthologue:
RP4-788L13.1
Human Description:
Lipid phosphate phosphatase-related protein type 4 [Source:UniProtKB/Swiss-Prot;Acc:Q7Z2D5]
Mouse Orthologue:
D3Bwg0562e
Mouse Description:
DNA segment, Chr 3, Brigham & Women's Genetics 0562 expressed Gene [Source:MGI Symbol;Acc:MGI:106530

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7490 Missense Mutation detected in F1 DNA Not yet available
sa13790 Essential Splice Site Available for shipment Available now
sa31271 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7490
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112131 Missense 126 775 3 7
ENSDART00000144624 Missense 126 765 3 7
Genomic Location (Zv9):
Chromosome 2 (position 18871732)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20700463
GRCz11 2 20358435
KASP Assay ID:
554-4006.1 (used for ordering genotyping assays)
KASP Sequence:
CAGAGGCTAACATAAATGCTGCTGGCTGCAATTTCAACTCTTACATCCGA[C/T]GGGCTGTGAGGTTTGTTGGTGGGTGTATATTTTTCCTGCACTTGTGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13790
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112131 Essential Splice Site 275 775 7 7
ENSDART00000144624 Essential Splice Site 275 765 7 7
Genomic Location (Zv9):
Chromosome 2 (position 18880951)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20709682
GRCz11 2 20367654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGTGCTCACTATCCTTACCAAGAGATTTCWGCCTTTTGCACTACTTTA[G/A]GGTCTGTATGCAGTTGGGAACTTTAAACCTAGTGAAGACACATCTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31271
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112131 Nonsense 710 775 7 7
ENSDART00000144624 Nonsense 710 765 7 7
Genomic Location (Zv9):
Chromosome 2 (position 18882257)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20710988
GRCz11 2 20368960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATCCCCACTTCCATCATCACCACCACCAACAGAGTATCACCACTATT[C/T]GAGTCACACCAGTGGAAGTCAGCAGTGAAGCCACCTCGGAGACTCTCTCC
Associated Phenotype:
Not determined