Busch Lab

ZMP

LOC568637

Ensembl ID:
ENSDARG00000079665
Human Orthologue:
GPR158
Human Description:
G protein-coupled receptor 158 [Source:HGNC Symbol;Acc:23689]
Mouse Orthologue:
Gpr158
Mouse Description:
G protein-coupled receptor 158 Gene [Source:MGI Symbol;Acc:MGI:2441697]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11487 Nonsense Available for shipment Available now
sa25775 Nonsense Mutation detected in F1 DNA Not yet available
sa9182 Nonsense Mutation detected in F1 DNA Not yet available
sa11073 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11487
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 59 1286 1 11
ENSDART00000113081 Nonsense 59 1286 1 11
Genomic Location (Zv9):
Chromosome 2 (position 12033826)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12458922
GRCz11 2 12242521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGACAAAGATCTCGAAATCAAGGCTAAATATCCTGTTTACAGCACCAGC[G/A]AGACGACGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTG
Long Flanking Sequence:
CGGGAACGATGGCCATTCAAAAGTCCTCAGTACAGTAACGGGGGAAAGGAGCTTTTGGAAACAATCAGCCCCCCGCCAGCTCCGAGCGAGCATTCGTTACTGATGTGAGTAGTGAACGCTACAGTAACCACGGCAGAAACGATGCTCTAGATATTTACCACTACATCTACGCGCTCGAGACAGATCCACAGAATGCCAGCGGTCTATAGATGTCGGTGTAGCGGTCGGTGTGTGGATTTGTCTGATTGAACCATTAGAGTTGAGTAACTTTTCAGAATGCACGTCTGTTTACATTGCGCCGAGGAATGGACGCACTTCTGAAGTGAATGTCAATGGAGAATGTTCACGGTGCTTGCTGGCGTCGCGGTATGGACGCGTTCCTGCTCTACCTTCTTCTGCTAATTGGGATTGCAAAGGGATCAAATTATGGCTACGTGGAATGGTCTGAGAGCGACAAAGATCTCGAAATCAAGGCTAAATATCCTGTTTACAGCACCAGC[G/A]AGACGACGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTGGCGCATAAGCTCGAGGAGGATCTTCCGCGGGTGGTCACCGCTTTCCTCCACACCGGAGACTCGTCCACCCTGGAGCATGTCAACTGCTCGCGGCGGTATGAGCTGAGCAGTCTTCGCGGTGGAGCTCACGCCGCCTCGCACTCCTCCCTCCAAGGCGTCCTCGACACCGTGGCACAAGCCACCAACTTCCTAAACATGCTCCTGCAGTCCAATACCTCCAAGGAGCAGCATTTGAGGATGGATATTCAGTGGTACCACGCGCTGGTGTCGAGTATGTTGGAAGGGAATCCTAAAATCCACCGGGCAGTGGTCACATTTCACATGGAGTCTCCTGAGGCGCCTGGTCCTCAGGTGTTTCTCCAGGCGACCAGAGGAGAGGAGCGCATAGTGCTTCAAGATCTGTCCACCACCGCGCGCCATCGCCTTAAAAACCGGACTTCTGAGTCCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25775
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 59 1286 1 11
ENSDART00000113081 Nonsense 59 1286 1 11
Genomic Location (Zv9):
Chromosome 2 (position 12033826)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12458922
GRCz11 2 12242521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGACAAAGATCTCGAAATCAAGGCTAAATATCCTGTTTACAGCACCAGC[G/T]AGACGACGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTG
Long Flanking Sequence:
CGGGAACGATGGCCATTCAAAAGTCCTCAGTACAGTAACGGGGGAAAGGAGCTTTTGGAAACAATCAGCCCCCCGCCAGCTCCGAGCGAGCATTCGTTACTGATGTGAGTAGTGAACGCTACAGTAACCACGGCAGAAACGATGCTCTAGATATTTACCACTACATCTACGCGCTCGAGACAGATCCACAGAATGCCAGCGGTCTATAGATGTCGGTGTAGCGGTCGGTGTGTGGATTTGTCTGATTGAACCATTAGAGTTGAGTAACTTTTCAGAATGCACGTCTGTTTACATTGCGCCGAGGAATGGACGCACTTCTGAAGTGAATGTCAATGGAGAATGTTCACGGTGCTTGCTGGCGTCGCGGTATGGACGCGTTCCTGCTCTACCTTCTTCTGCTAATTGGGATTGCAAAGGGATCAAATTATGGCTACGTGGAATGGTCTGAGAGCGACAAAGATCTCGAAATCAAGGCTAAATATCCTGTTTACAGCACCAGC[G/T]AGACGACGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTGGCGCATAAGCTCGAGGAGGATCTTCCGCGGGTGGTCACCGCTTTCCTCCACACCGGAGACTCGTCCACCCTGGAGCATGTCAACTGCTCGCGGCGGTATGAGCTGAGCAGTCTTCGCGGTGGAGCTCACGCCGCCTCGCACTCCTCCCTCCAAGGCGTCCTCGACACCGTGGCACAAGCCACCAACTTCCTAAACATGCTCCTGCAGTCCAATACCTCCAAGGAGCAGCATTTGAGGATGGATATTCAGTGGTACCACGCGCTGGTGTCGAGTATGTTGGAAGGGAATCCTAAAATCCACCGGGCAGTGGTCACATTTCACATGGAGTCTCCTGAGGCGCCTGGTCCTCAGGTGTTTCTCCAGGCGACCAGAGGAGAGGAGCGCATAGTGCTTCAAGATCTGTCCACCACCGCGCGCCATCGCCTTAAAAACCGGACTTCTGAGTCCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9182
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 78 1286 1 11
Genomic Location (Zv9):
Chromosome 2 (position 12033769)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12458865
GRCz11 2 12242464
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTGGCGCAT[A/T]AGCTCGAGGAGGATCTTCCGCGGGTGGTCAYCGCTTTCCTCCACACCGGA
Long Flanking Sequence:
GAAACAATCAGCCCCCCGCCAGCTCCGAGCGAGCATTCGTTACTGATGTGAGTAGTGAACGCTACAGTAACCACGGCAGAAACGATGCTCTAGATATTTACCACTACATCTACGCGCTCGAGACAGATCCACAGAATGCCAGCGGTCTATAGATGTCGGTGTAGCGGTCGGTGTGTGGATTTGTCTGATTGAACCATTAGAGTTGAGTAACTTTTCAGAATGCACGTCTGTTTACATTGCGCCGAGGAATGGACGCACTTCTGAAGTGAATGTCAATGGAGAATGTTCACGGTGCTTGCTGGCGTCGCGGTATGGACGCGTTCCTGCTCTACCTTCTTCTGCTAATTGGGATTGCAAAGGGATCAAATTATGGCTACGTGGAATGGTCTGAGAGCGACAAAGATCTCGAAATCAAGGCTAAATATCCTGTTTACAGCACCAGCGAGACGACGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTGGCGCAT[A/T]AGCTCGAGGAGGATCTTCCGCGGGTGGTCACCGCTTTCCTCCACACCGGAGACTCGTCCACCCTGGAGCATGTCAACTGCTCGCGGCGGTATGAGCTGAGCAGTCTTCGCGGTGGAGCTCACGCCGCCTCGCACTCCTCCCTCCAAGGCGTCCTCGACACCGTGGCACAAGCCACCAACTTCCTAAACATGCTCCTGCAGTCCAATACCTCCAAGGAGCAGCATTTGAGGATGGATATTCAGTGGTACCACGCGCTGGTGTCGAGTATGTTGGAAGGGAATCCTAAAATCCACCGGGCAGTGGTCACATTTCACATGGAGTCTCCTGAGGCGCCTGGTCCTCAGGTGTTTCTCCAGGCGACCAGAGGAGAGGAGCGCATAGTGCTTCAAGATCTGTCCACCACCGCGCGCCATCGCCTTAAAAACCGGACTTCTGAGTCCGACTGGTACAACGTGTTTCGGGACCGAAATAAACACAAGCGGCTGGTTAAAAGTAGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11073
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 254 1286 1 11
Genomic Location (Zv9):
Chromosome 2 (position 12033240)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12458336
GRCz11 2 12241935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGGCTGGTTAAAARTAGAGCGTTTCCAGCAGCGCATGGCGGATATTTTT[T/A]AGRCAAAAGTCATGTCAAGTGGTCTTCGCCTTATCTAGAGTGCGAGCACG
Long Flanking Sequence:
CACCGCTTTCCTCCACACCGGAGACTCGTCCACCCTGGAGCATGTCAACTGCTCGCGGCGGTATGAGCTGAGCAGTCTTCGCGGTGGAGCTCACGCCGCCTCGCACTCCTCCCTCCAAGGCGTCCTCGACACCGTGGCACAAGCCACCAACTTCCTAAACATGCTCCTGCAGTCCAATACCTCCAAGGAGCAGCATTTGAGGATGGATATTCAGTGGTACCACGCGCTGGTGTCGAGTATGTTGGAAGGGAATCCTAAAATCCACCGGGCAGTGGTCACATTTCACATGGAGTCTCCTGAGGCGCCTGGTCCTCAGGTGTTTCTCCAGGCGACCAGAGGAGAGGAGCGCATAGTGCTTCAAGATCTGTCCACCACCGCGCGCCATCGCCTTAAAAACCGGACTTCTGAGTCCGACTGGTACAACGTGTTTCGGGACCGAAATAAACACAAGCGGCTGGTTAAAAGTAGAGCGTTTCCAGCAGCGCATGGCGGATATTTTT[T/A]AGACAAAAGTCATGTCAAGTGGTCTTCGCCTTATCTAGAGTGCGAGCACGGCAGGTTTGTGCCGCACTGGCTTTTAACGATTTCTGCTGGCTTCTATGGCTTGAAGAATAAGACGGCGCCCGAGTTTAGGTAAGCCACACTGTTCAAGAACTTTAGCTATACATGAACATTGAAGACTATACAAACTGAACAACGAATTAGAATTTTGACTTTGTTTCTTTTTAAACAAAACTTAAAATTTAACATAAAGAATTGTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTAATTATATGATGGGAAAAATGATGCAGGGTAGGCTACATTATGCACTTTTGGCCACAAAATCATCTAAACATTTCTTGAAGAAAATGAATATAAACTTCACTAAACACAACCCATTTTGTGGGGTAAACTTGCACAATAATTGTTCATAAAATAAAAAGACACAACAAATGTCCATGGTAAAACACTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8078
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Essential Splice Site 437 1286 4 11
Genomic Location (Zv9):
Chromosome 2 (position 11947061)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12372157
GRCz11 2 12155756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGGACTTYATCAGCATGGTKGTCGTCTACCATTTTCGACACAACAAGG[T/C]AGGAATGTTTACTGCCAGTTGTCTTGCCTGGAAAGACTCTKTACTCTRTT
Long Flanking Sequence:
AATAAGGTTCATTTTTGAAAATATAATATAATATAATATTATAATATATATATATATATATATACTGGGAACGTTTATCATTATTATATTTATTATTATTATTATTATTATTATTATTATTATTAGTGATTAATAAAAGTAAAGCATTATTGATATTAAGTACATAATGGTTTTAACTTATAATCAACTATTGTAATAATACTACAGATATCATCACAGCACTGTTTAAAATGTTAACACACAGCTGATATGATATGATAGTATTCATGTGATTCACCTGCTGTTAGAAACAGACCTTGGAACGTACACTGATGAATCATGGGAATTGTCTGGGAGGTGTTTGCCCTGTCGAGAAGGCTGTGAGTTCTGCCGGGACGACACACCATGTCTGGCTCATGAAGACACGGCTCTGCGTCTGGCCATGGTCTCCTTCCAGGGGTTCTGCATGCTCTTGGACTTTATCAGCATGGTGGTCGTCTACCATTTTCGACACAACAAGG[T/C]AGGAATGTTTACTGCCAGTTGTCTTGCCTGGAAAGACTCTTTACTCTGTTTTGCTTTTATTCTGCTAGAGTTACCTGAACCAAAGAACAACAAGAGCTTTGGTTCTGCTTGAGTGCATTTATTGACCTGAAGGGCAAATACTGCTTTAAAAAAATAAAAAAGTTTATATTTCAGCTTTTTTTCTTTTATTCCCACTCCCCCACTCTTTTCTCTCTCTCTTTTAGAGAATCAAAGCATCTGGTCTTATACTTCTTGAAGCAATTCTTTCAGGATCTGTACTTCTTTACTTCCCTGTAAGTTCCAACAAATGTTCTACTCCTCTATCTAAATGAACGAGTAAAATATGTCTGTCATGAAATATGTCTGTCATGCTTGAAACCTATTTACTTGACCATTTTTGAATGCACATTATATACTAAATAATCTGATTGGTATTTTAAGATGAAATCTTACAGACATATTCTGGAGTATATGAGATGAACTCAGAGCTTCCTTGTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25774
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Essential Splice Site 497 1286 7 11
Genomic Location (Zv9):
Chromosome 2 (position 11927741)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12352837
GRCz11 2 12136436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATATATCTGACTGCTATATTTGTGTCTTGTCTTTCTATCACACACCAA[A/G]GGGTTTTAAAGGTGTTTCTGTCACGGACGGCCCAGCGAATTCCCTACATG
Long Flanking Sequence:
GTGGCCACAACTGCATCAATTTGTCTTGGTAATGAAAGATACAAGTCCTGAACAGTGGCTAGAAGGATGTTGAGCCACTGTTTTTGCAGAAACACCAAAAACACCCAAAGTGGCTCAATAATATTTAGTTCTGGTGACTGTGCAGGCCATGGGAGATGTTCAACTTCACTTTCACGTTCATCAAACCACTCTGTCAGAAGTCTTGCTGTGTGTATTGCGGCATTATCATCCTAATACACAGCACCGCATTCAGGATATAATGTTTGAACCATGGGTCCTCCAGAATGGTTCAGTAGTCCTTAGCAGTAAACTACTTATAGACATCTAATATAAACTGTGGCTGAAAAATTATCGTAATGACAATATTACTTTTACTGTATTTTGGATGAACAAATACATTAGCAATAGATTTCTTTCAATACATTTACAAAACAATTTCTTTGTATATGGTCATATATCTGACTGCTATATTTGTGTCTTGTCTTTCTATCACACACCAA[A/G]GGGTTTTAAAGGTGTTTCTGTCACGGACGGCCCAGCGAATTCCCTACATGACCAGCTGGAGGGTTCTGCGTCTGCTTGCTGTGATTTTGCTGGTGGTCATGTGGTTCCTGGCGGCGTGGACCTCTGCCGTATGTCAGAACCACAACACACGTCATGCCCTCATTGACATCGGTGTCACTCCAGAGGGCCTGCAGTTCAGCATGTGCCTACTGGACAGCTGGGACTACATGATGGCTGCGGGTCAGTTCTTATTCTTGGTTTTATTCTGCTTGAACCAGCAACAGAGAGCAAAATACATCTAGAAGGTCAAAATGTATAAATGGATCAGTGTCACAACATGAGTAGTCTAATGTTTTGTCTATACAGTCCAACTACTGTTTAAACATTGTTAGTCAGCTACTTCAATATATTTAAAATAGTCTCTTTTTACTCACTGAGGATGATTAAAGTGTAGTGAAAACAGAAATATTGTAAAATAGTTTAATAGTATTAATTTAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3396
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 1244 1286 11 11
Genomic Location (Zv9):
Chromosome 2 (position 11899972)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12325068
GRCz11 2 12108667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCAGCAGTAAGCGTACTGAWGTTTGCCCCTGGGAGACAGAGGCACTAT[C/A]AAGTGTTACCTCACATGATAAAGATMCTCCAWCAACTGAAAACCACACAA
Long Flanking Sequence:
AGATTCATCACTCCAAGCTATGGACACTGCGGGACTGTCCCCTGAGAGAATCAGTCGCAAGAAAAGTGTCACCCCAACAGACGGAAAGCCCAAGATTTTCCTCTCAGATATCTCCAAGTCCACAGGAAGCCTTTTGCAGCCTCCAGCTCTTATGGTGGATATCTGCCCTTGGGATTTTGATCCCCCCCTGTCCCCCAACCAAGACAAAACATCCAGCCCCATACATCATTCAAAGAGAAGAGATTCTTCCTCCAAAAGAAAAGGATTGTCTTCTAAAGAGAAAGCGATGAAGGATAAAGATGATGAAAAACGAAGCTCTAAAATTAAGGAGCGGAGAAGCTCCTCAAGCAGAACCTCCGAGAAACGACGTACAAGCCAATCATCAGAGGGTGATCAAGCTGCCATGGTGGCATCCAGCAGAAGGAGGAGCTCGACTAGAGACACCGCTTTCAGCAGCAGTAAGCGTACTGAAGTTTGCCCCTGGGAGACAGAGGCACTAT[C/A]AAGTGTTACCTCACATGATAAAGATACTCCATCAACTGAAAACCACACAACCCAAACACCACCCACTTACCTCAACATGGCTGACGTTTGTCCATGGGACTATGATGAGAAGTCAGGAAAAAGTGCATGACACTACACTCACGATGTTAGACCATTTTAGCAAGGTTTATGAGATGGCAGATTCCATATTTAAAAGTTAAGACCCGTTCACACCAAGAACGTTAACTCTAATGATAATCAAATTAAGTGCACACTGCGGTTATGTTGTCTGCTGCTTAAATACTCGAAGTCCTTAAAAGTGAAATCTGATTGGCTGTCAATGTTTTCATCATTCTGCAGCTGAAATGTTTTTTTCTGAAAGTGATTGCAGTTATATAAATCCTCTGTGTCAATATTGTTCAGACTGTGGTGTGACTTTCTTATTCTCATAGAACTAGATCAGTCTGTTGTTATAGTTATTCTACTTGGTGTAAGCGGGCCTTTATCCCTATGTTTATGCC
Associated Phenotype:
Not determined