Busch Lab

ZMP

LOC797104

Ensembl ID:
ENSDARG00000079656
Human Orthologue:
FAM171A2
Human Description:
family with sequence similarity 171, member A2 [Source:HGNC Symbol;Acc:30480]
Mouse Orthologue:
Fam171a2
Mouse Description:
family with sequence similarity 171, member A2 Gene [Source:MGI Symbol;Acc:MGI:2448496]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37946 Nonsense Mutation detected in F1 DNA Not yet available
sa3268 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa37946
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Nonsense 208 849 5 8
Genomic Location (Zv9):
Chromosome 24 (position 38319617)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36927964
GRCz11 24 36815594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGAAAATGGCTGGACGGACCTGACAACGATAGCAGCAGTCAGTGCA[C/T]AGTTGTTTGACCGCGAGGGCCGAGCTGTTGAAGTCAGTGAGCCTGTCCAC
Long Flanking Sequence:
CAACGTAATTTACGTAATTTAACGTCGTTTTTGGGCGTTAAAATAACGTTGTCCTTTGATGCTGGCTAGACAATGAATTTGGTCACCTGACGTCACAACCTAAATCTAACCTTATTTTAATGTCTTATGAAGTTGTGTGCCTGCTGCGATGGGTTCTGAAATACTGGCAGGGGGCTGGTTATAGAGACCAAAACAAAGACAGACATTTTGGCGCACATTTTCAAAGCAGAATAACTGACCTTAGTGTTGTTTCTATACAACAGATAAACAAGTATGTTCACCTAGCATGCTTCTCAAATATCTGGAAACTTATTACAGTATTTTAATGCTTTATAAAAGTCAAAAAACATACATACAGCACCTTTAATAAATGCTCATGAGACTTTTTAGATTGCATATATGTAGGGGAGCCTTGATGTGTGAATGTTCATGATGGTGTAATCATTTAAGGAGGAGAAAATGGCTGGACGGACCTGACAACGATAGCAGCAGTCAGTGCA[C/T]AGTTGTTTGACCGCGAGGGCCGAGCTGTTGAAGTCAGTGAGCCTGTCCACATCTCTGTGCCTCTGCCGTCTGATACACACATACGATCTGCCAGCAGCATACCTGTATGGATGTACGACACCAAGACAGGTACAATCACGCCTTAGAAACCTTAAAGGTTTAGTACGCATAATAAAATCCCTGTATTCATTTACTCATTGAGTTTCCTTCTTCTGTTCGAAGTTATTAAGAAGTTATTTAAAAGAATGCTGGTTGATGCTACCCATTGACTTCCATGGTAATGGAAGATGTTTATTTAAAGATGTACTGTAGCAGACGTCGTTTATGCAATTGTACAAATCAAAAATTGTAATGCATTATGACAATTAAAGCCTAAATATTGCTAGATCCTCATTTTGGAAATAACCTTTGATGTCCAGGACTTTGGGTTCGAAATGGAACAGGATTTATCATTCGAGAGGGATCTCAGCTAAGATGGGACTTCACTGCGTCCCAGCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30132
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Essential Splice Site 251 849 5 8
Genomic Location (Zv9):
Chromosome 24 (position 38319486)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36927833
GRCz11 24 36815463
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACGATCTGCCAGCAGCATACCTGTATGGATGTACGACACCAAGACAGG[T/C]ACAATCACGCCTTAGAAACCTTAAAGGTTTAGTACGCATAATAAAATCCC
Long Flanking Sequence:
GTTGTGTGCCTGCTGCGATGGGTTCTGAAATACTGGCAGGGGGCTGGTTATAGAGACCAAAACAAAGACAGACATTTTGGCGCACATTTTCAAAGCAGAATAACTGACCTTAGTGTTGTTTCTATACAACAGATAAACAAGTATGTTCACCTAGCATGCTTCTCAAATATCTGGAAACTTATTACAGTATTTTAATGCTTTATAAAAGTCAAAAAACATACATACAGCACCTTTAATAAATGCTCATGAGACTTTTTAGATTGCATATATGTAGGGGAGCCTTGATGTGTGAATGTTCATGATGGTGTAATCATTTAAGGAGGAGAAAATGGCTGGACGGACCTGACAACGATAGCAGCAGTCAGTGCACAGTTGTTTGACCGCGAGGGCCGAGCTGTTGAAGTCAGTGAGCCTGTCCACATCTCTGTGCCTCTGCCGTCTGATACACACATACGATCTGCCAGCAGCATACCTGTATGGATGTACGACACCAAGACAGG[T/C]ACAATCACGCCTTAGAAACCTTAAAGGTTTAGTACGCATAATAAAATCCCTGTATTCATTTACTCATTGAGTTTCCTTCTTCTGTTCGAAGTTATTAAGAAGTTATTTAAAAGAATGCTGGTTGATGCTACCCATTGACTTCCATGGTAATGGAAGATGTTTATTTAAAGATGTACTGTAGCAGACGTCGTTTATGCAATTGTACAAATCAAAAATTGTAATGCATTATGACAATTAAAGCCTAAATATTGCTAGATCCTCATTTTGGAAATAACCTTTGATGTCCAGGACTTTGGGTTCGAAATGGAACAGGATTTATCATTCGAGAGGGATCTCAGCTAAGATGGGACTTCACTGCGTCCCAGCTGGGCTACTGGATCGCTGCCTTCCGAGCTTCATCAGGTGATACACCCAAATGCAAAAACACACATATTTGCATCTTGACTCAAGCACAAAAATGCTGATCCTGCTTTGTATTTGTACACAAGGCTCAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8046
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Essential Splice Site 331 849 8 8
Genomic Location (Zv9):
Chromosome 24 (position 38318421)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36926768
GRCz11 24 36814398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCGYAAGATATCTTTTGAAGATTTGCTAAATGTCAGCATYTGTTTTCC[A/T]GACGAAGGTGTCTGAAGCCCCGACGGCAGCAGAAACAGGTTCAAGTTCCA
Long Flanking Sequence:
TCTCGCTCTGCTTGTGCTAGTCTTGCTCTGTGTCTTACTCTACTACTGCAGGTGTGTATTTGTAGACTAGCTTGCCTAGTCTTTGTCTAAAACAGGGGTCACCAATCTCGGTCCTGGAGGGCCGGTGTCCCTTCAGGGTTTAGCTCCAACTTGCCTCAACACACCTGCCTGGATGTTTCAAGTATACCTAGTAAGAGCTTGATTAGCTTGTTCAGGTGTGTTTGATTAGGGTTGGAGCTAAAATCTGAAGGACACTGGCCCTCCAGGAACAAGTTTGGTGACCATTGGTCTAAACCAGGGGTCACCAATCTCTTTTGCTTTTCCTTAAACTATTGGTAATATTTAGAGCGGGGTGTAGATTTCATTCCACTCACTGTACATTATAACTAGCAAAACAACACCAACATACCAAATGTCACCTTAAGCAATGTTTTCCCAATGAGCCTGATTGATCGTAAGATATCTTTTGAAGATTTGCTAAATGTCAGCATCTGTTTTCC[A/T]GACGAAGGTGTCTGAAGCCCCGACGGCAGCAGAAACAGGTTCAAGTTCCATCTGCTTTGAATGGATCCAGGAAGGACCAAGGCACCTCCACGTCCCACTTGAACCTCATCTGCGGAGGCCATGTTGAATCTGCTGCCTCCAATGGCAACTTGGACGCCAATAAATCCGAGGGATCCCCATCCCATGCCTTCAAAAGTGCCCGAGATGAGTTTACCCGGCACATTCCTGCCCATAAGCTACGCCATTCCTCAAAGAACAAGCAATCCAAAGGAGCCCAAAGAAATCCCGAGAGTTTCCCCATGAAGGTGCATCAATCTACAGATACAAGCAATCTGGATAGCAATCTTCTACATGAAAACTACGGCCGCAACTACAGTTCTGACGACAAGGATCAAGACTATCGCCGCAGACATGTTGTCAATGATAACCGAGGCTACACATCCGACCCGCCTTCCCCACCACTTGTTGACAAGCCTCCAGAGTATTCACAGGTTTTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3268
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Nonsense 455 849 8 8
Genomic Location (Zv9):
Chromosome 24 (position 38318047)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36926394
GRCz11 24 36814024
KASP Assay ID:
554-3078.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAGCAATCTGGATRGCAATCTTCTACATGAAAACTACGGCCGCAACTA[C/A]AGTTCTGACGACAAGGATCAAGACTATCGCCGCAGACATGTTGTCAATGA
Long Flanking Sequence:
TGTACATTATAACTAGCAAAACAACACCAACATACCAAATGTCACCTTAAGCAATGTTTTCCCAATGAGCCTGATTGATCGTAAGATATCTTTTGAAGATTTGCTAAATGTCAGCATCTGTTTTCCAGACGAAGGTGTCTGAAGCCCCGACGGCAGCAGAAACAGGTTCAAGTTCCATCTGCTTTGAATGGATCCAGGAAGGACCAAGGCACCTCCACGTCCCACTTGAACCTCATCTGCGGAGGCCATGTTGAATCTGCTGCCTCCAATGGCAACTTGGACGCCAATAAATCCGAGGGATCCCCATCCCATGCCTTCAAAAGTGCCCGAGATGAGTTTACCCGGCACATTCCTGCCCATAAGCTACGCCATTCCTCAAAGAACAAGCAATCCAAAGGAGCCCAAAGAAATCCCGAGAGTTTCCCCATGAAGGTGCATCAATCTACAGATACAAGCAATCTGGATAGCAATCTTCTACATGAAAACTACGGCCGCAACTA[C/A]AGTTCTGACGACAAGGATCAAGACTATCGCCGCAGACATGTTGTCAATGATAACCGAGGCTACACATCCGACCCGCCTTCCCCACCACTTGTTGACAAGCCTCCAGAGTATTCACAGGTTTTGCAAGGGCCAGATCATCTCGCTCGTCCAACATCACTCAACACACAACCAGGTCAGATTATATTCTGCAGCTCATTAGATCAGATGAAGGAGAACATGTATCGTACTATGGTACCAACTCTTGTAATCCCAGCCCACTACATGAGGTTCTCCTCTGAGTTTGGTGGCTCAGATCAAGGTAAGGATGGAACAAATCAATCAGATCGAGATGGACAGAGTTCACAAGGTACCAGCAGTGGGATTCAAAGCCAAATCCATCAAGGACAGACCCCAGGATCAGGACATACCGATGGCCAGCAAGGTGCATCTCCTGCAGGCTCTGATGACAGCGTTTGGCCCTCCAGTGGTACACCAGCTCCGGTCCACATTCCAGTTTTATT
Associated Phenotype:
Not determined