Busch Lab

ZMP

st3gal1

Ensembl ID:
ENSDARG00000079654
ZFIN ID:
ZDB-GENE-060321-1
Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 1 [Source:UniProtKB/TrEMBL;Acc:B8K0D0]
Human Orthologue:
ST3GAL1
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 1 [Source:HGNC Symbol;Acc:10862]
Mouse Orthologue:
St3gal1
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:98304]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36763 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36763
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110551 Nonsense 35 177 2 6
ENSDART00000113088 Nonsense 85 321 1 6
ENSDART00000135327 Nonsense 28 179 1 4
ENSDART00000141336 Nonsense 35 94 3 4
ENSDART00000146684 Nonsense 85 267 3 7
ENSDART00000147510 Nonsense 60 202 4 7
Genomic Location (Zv9):
Chromosome 19 (position 5409684)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4868995
GRCz11 19 4785481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCTGCTGAACAGGAGAAACAGCGCAATGCGGTCGGACGTCTTCGAGT[G/A]GTGGCAGGTAGCTACACAGCTTTTAAATAAGTTCATGATATTTTTTGGTA
Associated Phenotype:
Not determined