Busch Lab

ZMP

LOC569968

Ensembl ID:
ENSDARG00000079622
Human Orthologue:
FRMD5
Human Description:
FERM domain containing 5 [Source:HGNC Symbol;Acc:28214]
Mouse Orthologue:
Frmd5
Mouse Description:
FERM domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442557]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11096 Essential Splice Site Available for shipment Available now
sa25366 Nonsense Mutation detected in F1 DNA Not yet available
sa31577 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11096
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Essential Splice Site 142 572 5 14
Genomic Location (Zv9):
Chromosome 7 (position 31487928)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29880270
GRCz11 7 30151420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGTGCAAAAGTTCAGACGCTGCAACGCTGRCTGCATTCATACTGCAGG[G/A]TAAAAGCAAACCACAGTCACAGGAGCCAYTCTTTACAATATTAGCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25366
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Nonsense 361 572 13 14
Genomic Location (Zv9):
Chromosome 7 (position 31482883)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29875225
GRCz11 7 30146375
KASP Assay ID:
554-7557.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCTGGGATGGTGCCCAGCAGGAGTTGTCCATCCATCACACATGGCCCA[C/T]GACAAAGCAGCGTCCCCCGAACTCGGAGGAGAGCCGTCCATATTTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31577
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Nonsense 455 572 14 14
Genomic Location (Zv9):
Chromosome 7 (position 31476357)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29868699
GRCz11 7 30139849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCATCAGACCCGGCTCAGGTTCGCCACACAAATGGCCCTCGCAACATC[C/T]AAGAGGAAGGAGGAACAGAACAGTGCTCTCAGAACCAAGCCAGACCACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26967
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Nonsense 564 572 14 14
Genomic Location (Zv9):
Chromosome 7 (position 31476029)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29868371
GRCz11 7 30139521
KASP Assay ID:
2259-8965.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATGAATACTTTTGCCCACTTAGGCGCTGGCTGGCCTGTAAGCTGCGTT[G/A]GATGGGAGGGCATCTCATTAATAAATAAATGAGACGTGGGACATTCTAAG
Associated Phenotype:
Not determined