Busch Lab

ZMP

sik2a

Ensembl ID:
ENSDARG00000079618
ZFIN ID:
ZDB-GENE-070705-451
Description:
salt-inducible kinase 2a [Source:RefSeq peptide;Acc:NP_001103338]
Human Orthologue:
SIK2
Human Description:
salt-inducible kinase 2 [Source:HGNC Symbol;Acc:21680]
Mouse Orthologue:
Sik2
Mouse Description:
salt inducible kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2445031]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa26591 Nonsense Mutation detected in F1 DNA Not yet available
sa20547 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26591
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089961 Nonsense 140 339 3 5
ENSDART00000145959 Nonsense 643 842 13 15

The following transcripts of ENSDARG00000079618 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 59166979)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57147651
GRCz11 5 57817868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATAATTTCAGGGAGAAGGACGGCCATGTCTTGGTGGAAAAGATCCAT[C/A]GACATTCACTGGAAAAATGCACCCTTATTTGCTGTCTAGGAGACAGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20547
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089961 Nonsense 184 339 4 5
ENSDART00000145959 Nonsense 687 842 14 15

The following transcripts of ENSDARG00000079618 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 59164104)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57144776
GRCz11 5 57814993
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGAGCCAGTCAGTTGGCAAGCGGCCTTGGAAGTGGCCAGATGTTTTGT[A/T]AAGAGGCTGCACCGCGCACTTTAGAGCAACAACTCCAGGAACACAGGTCA
Associated Phenotype:
Not determined