Busch Lab

ZMP

sall3

Ensembl ID:
ENSDARG00000079613
ZFIN ID:
ZDB-GENE-020228-4
Description:
Putative spalt protein [Source:UniProtKB/TrEMBL;Acc:Q9DGH1]
Human Orthologue:
SALL3
Human Description:
sal-like 3 (Drosophila) [Source:HGNC Symbol;Acc:10527]
Mouse Orthologue:
Sall3
Mouse Description:
sal-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109295]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1106
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109276 Nonsense 819 1322 2 4
Genomic Location (Zv9):
Chromosome 16 (position 7863994)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6709726
GRCz11 16 6650404
KASP Assay ID:
554-1008.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGATCAAAGCCCCCTCTCCGGGTACAGCACTCTTGTCCTATATGCCAG[A/T]AAAAGTTTACTAATGCCGTAGTTCTGCAGCAACACATTCGCATGCATATG
Associated Phenotype:
Not determined