Busch Lab

ZMP

sc:d411

Ensembl ID:
ENSDARG00000079611
ZFIN ID:
ZDB-GENE-080303-16
Description:
semaphorin-4C [Source:RefSeq peptide;Acc:NP_001121718]
Human Orthologue:
SEMA4C
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4c
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa33554 Nonsense Mutation detected in F1 DNA Not yet available
sa12361 Nonsense Available for shipment Available now
sa30613 Nonsense Mutation detected in F1 DNA Not yet available
sa20362 Nonsense Available for shipment Available now
sa20361 Nonsense Available for shipment Available now
sa25291 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33553 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33554
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 49 863 2 14
Genomic Location (Zv9):
Chromosome 5 (position 16268797)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14064665
GRCz11 5 14564882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCAGATGTGCATGACAGTATGGCGAGGTTTCGTGCTGTCGGGGTGTG[G/A]AACTACACCATGTTGACCCTGGCAGAACACGAGAGGGTTTTGTATGTGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8177
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 64 863 2 14
Genomic Location (Zv9):
Chromosome 5 (position 16268752)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14064620
GRCz11 5 14564837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGGAACTACACCATGTTGACCCTGGCAGAACACGAGAGGGTTTTGTA[T/A]GTGGGYGCCAGAGAGAACATCTTCGCCCTGGATCCCAACGACATCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12361
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 126 863 4 14
Genomic Location (Zv9):
Chromosome 5 (position 16264935)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14060803
GRCz11 5 14561020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTTCAACTACATTCGCTTCCTGCAGAGCTACAATCACACGCACCTGTA[T/A]ACATGCGGGACGTACGCCTTCCAGCCYAAAKGCACCTACATTGTGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30613
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 188 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258124)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053992
GRCz11 5 14554209
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTAGACAAAGAGTTGTACTCCGCCACCCTCAATAACTTTCTGGGCACC[G/T]AGCCCGTAATCCTGAGGAACCTGGGACAACAGCATTACAGCATGAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20362
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 200 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258086)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053954
GRCz11 5 14554171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGGCACCGAGCCCGTAATCCTGAGGAACCTGGGACAACAGCATTA[C/A]AGCATGAAGAGTGAATACCTGCCGGCCTGGCTCAACGGTGAGGATCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20361
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 206 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053936
GRCz11 5 14554153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATCCTGAGGAACCTGGGACAACAGCATTACAGCATGAAGAGTGAATA[C/A]CTGCCGGCCTGGCTCAACGGTGAGGATCAAAACACACACATAAGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25291
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Essential Splice Site 213 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258047)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053915
GRCz11 5 14554132
KASP Assay ID:
554-7660.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGCATTACAGCATGAAGAGTGAATACCTGCCGGCCTGGCTCAACGG[T/C]GAGGATCAAAACACACACATAAGCAAAATATACTGTATGTGGTGCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33553
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 367 863 9 14
Genomic Location (Zv9):
Chromosome 5 (position 16242683)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14038551
GRCz11 5 14538768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGTCGTCTCAGCGATGGGGCCGTTACACTGGCACTGTGCCCAGTCCA[C/T]GACCTGGAGCGGTGAGCAGAGCGGCCGTTCAGATGGGAGGCCAGCCGAGA
Associated Phenotype:
Not determined