Busch Lab

ZMP

akap9

Ensembl ID:
ENSDARG00000079610
ZFIN ID:
ZDB-GENE-030131-7276
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa25075 Nonsense Mutation detected in F1 DNA Not yet available
sa29112 Nonsense Mutation detected in F1 DNA Not yet available
sa43191 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36744 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25075
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 441 2229 5 30
Genomic Location (Zv9):
Chromosome 19 (position 539832)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 561319
GRCz11 19 561128
KASP Assay ID:
554-7390.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGCAGAAGGTGGAGGAGCTGACGACTGAATGCAATTCTCTGCACCTT[C/T]AATATGAACAACTTCAGGAGGAGACGAGGGATCACGAGGACATGAAGAAG
Long Flanking Sequence:
TGGAGGAACTGACAGCTGAATCAAACGCACTACGCCTGCAATGTGAACAAGTGCAGGTGGAGACGAGAGATCCAGAGGAGATGAAGCTGAAGATGGAGGAACTGACCAATGAATCCAATACACTACAACTTCAAGATGAACAACTGCAGGGAGGGACGAGAGATCATGAGGAGGTGAAGAACATGGAGGAACTGACAACTGAATGCAATTCTCTGCGCCTTCAATGTGAACAACTGCAGGAAGAGACGAGAGATTATAAGGAGATGAAGCAGAGGGTGGAGGAACTGACCAAAGAATCCAATGCACTACGCCTTCAATATGAACAACTGCAGGAGGAGACGAGAAATCATGAGGAGATGAAGAAGAAGATGGAGGAACTGACCAATGATTCCAATGCACTACGCCTTCAATATGAACAACTGCAGGCGGAGACGAGAGATCATGAGGAGATGAAGCAGAAGGTGGAGGAGCTGACGACTGAATGCAATTCTCTGCACCTT[C/T]AATATGAACAACTTCAGGAGGAGACGAGGGATCACGAGGACATGAAGAAGAAGATAGAGGAGCTGACCAATGAATTCAATACTCTACGCCTGCAATATGACCAACTGCAGGAGGAGACCAGAGATCACGAGAAAATGAAGTTGAAGATGGAGGCGGTGACGACTGAATGCAATACGCTACGCTTACGATACGAGCAGTTGCAAGAGGAGACAAGGGATCATGAGGAGATGGGTAAGAAGATGCAGGAGGTGTCCAATGAATCCAATACACTACGCCTTCAATATGAACAACTGCAGGCAGAGATGAAAGATCACGAGGAGATGAAGCAGAAGATGGAAGGCATGACGACAGAGAGAGACTCTCTGCATCTCCAATATGAACGCCTCCATCAGGAGACTCTTCTGGAGCTGCAGGAGGCGCTGCGGGAGAAAACCGCAGCGTCTGTGGTGATGCAGGCTCAGGTGCAGGCGCTGGAGGAGAGCGCAGCCGCCAGGGTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29112
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 477 2229 5 30
Genomic Location (Zv9):
Chromosome 19 (position 539940)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 561427
GRCz11 19 561236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTGACCAATGAATTCAATACTCTACGCCTGCAATATGACCAACTG[C/T]AGGAGGAGACCAGAGATCACGAGAAAATGAAGTTGAAGATGGAGGCGGTG
Long Flanking Sequence:
ATGAATCCAATACACTACAACTTCAAGATGAACAACTGCAGGGAGGGACGAGAGATCATGAGGAGGTGAAGAACATGGAGGAACTGACAACTGAATGCAATTCTCTGCGCCTTCAATGTGAACAACTGCAGGAAGAGACGAGAGATTATAAGGAGATGAAGCAGAGGGTGGAGGAACTGACCAAAGAATCCAATGCACTACGCCTTCAATATGAACAACTGCAGGAGGAGACGAGAAATCATGAGGAGATGAAGAAGAAGATGGAGGAACTGACCAATGATTCCAATGCACTACGCCTTCAATATGAACAACTGCAGGCGGAGACGAGAGATCATGAGGAGATGAAGCAGAAGGTGGAGGAGCTGACGACTGAATGCAATTCTCTGCACCTTCAATATGAACAACTTCAGGAGGAGACGAGGGATCACGAGGACATGAAGAAGAAGATAGAGGAGCTGACCAATGAATTCAATACTCTACGCCTGCAATATGACCAACTG[C/T]AGGAGGAGACCAGAGATCACGAGAAAATGAAGTTGAAGATGGAGGCGGTGACGACTGAATGCAATACGCTACGCTTACGATACGAGCAGTTGCAAGAGGAGACAAGGGATCATGAGGAGATGGGTAAGAAGATGCAGGAGGTGTCCAATGAATCCAATACACTACGCCTTCAATATGAACAACTGCAGGCAGAGATGAAAGATCACGAGGAGATGAAGCAGAAGATGGAAGGCATGACGACAGAGAGAGACTCTCTGCATCTCCAATATGAACGCCTCCATCAGGAGACTCTTCTGGAGCTGCAGGAGGCGCTGCGGGAGAAAACCGCAGCGTCTGTGGTGATGCAGGCTCAGGTGCAGGCGCTGGAGGAGAGCGCAGCCGCCAGGGTCGACAGTCTGAGCCGGCGGGTAGAGGAGCTGCAGGAGTGTGTGGAGGAGAAGGACCGGGAGCTCCGAGCCTGCAGGATGAGGGTGGAACAAGCTCAAACTGATGCCCACGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7869
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 670 2229 5 30
Genomic Location (Zv9):
Chromosome 19 (position 540519)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 562006
GRCz11 19 561815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAATCTCAGGGAGAAAGTGGCTGCCGTTTTGGTCAGTCAAGCACAACTG[G/T]AAGCYGTTCAGACGCAAACCAAAGAGCTCCAYGCTGAGGCTATAGTAGGC
Long Flanking Sequence:
GATACGAGCAGTTGCAAGAGGAGACAAGGGATCATGAGGAGATGGGTAAGAAGATGCAGGAGGTGTCCAATGAATCCAATACACTACGCCTTCAATATGAACAACTGCAGGCAGAGATGAAAGATCACGAGGAGATGAAGCAGAAGATGGAAGGCATGACGACAGAGAGAGACTCTCTGCATCTCCAATATGAACGCCTCCATCAGGAGACTCTTCTGGAGCTGCAGGAGGCGCTGCGGGAGAAAACCGCAGCGTCTGTGGTGATGCAGGCTCAGGTGCAGGCGCTGGAGGAGAGCGCAGCCGCCAGGGTCGACAGTCTGAGCCGGCGGGTAGAGGAGCTGCAGGAGTGTGTGGAGGAGAAGGACCGGGAGCTCCGAGCCTGCAGGATGAGGGTGGAACAAGCTCAAACTGATGCCCACGGACTGTACGATAAAGTGGCTCAGCTTGAGGACAATCTCAGGGAGAAAGTGGCTGCCGTTTTGGTCAGTCAAGCACAACTG[G/T]AAGCCGTTCAGACGCAAACCAAAGAGCTCCACGCTGAGGCTATAGTAGGCTCCGGAACACAGCTGCAAGAGGGCATCTGGATGCAGGATGATCTAATGGCACAGGTGGGCCTCAGGGTGCAGAAGAGCCTCAGGATGCAGGAGGATTTCACTGTGCAGGAGGGCCTTGAGGTGCAGGAGGGTCGAACGACGCTGGAGGGCCTCACAGTACAGGAGGGTCTCACAATGCTGCCGGGCCTCACAATGCAGGAGGGCTTCAGGGCGCAGGCTAAAGCCTCTGGAGGGAAGGTGAACTTGCTGACGGAGAAGCTGAAGGAGCTGGAGGAGGGCTTGATTGTCATGCAGAAGGACCAGGAGTTGCAGAAGGAGCTGTTGTGTAGCTCTGAGGAGGAGGTGATGGAGTATGAGAGCAGGTTATCCGTCATGATGGACCTGCTCAGCCAGATGAAAACCAAACCCAGCGCTCTCAGACCACTGCCGTCGTCTCAGGTGAGTCTTTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4774
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 780 2229 5 30
Genomic Location (Zv9):
Chromosome 19 (position 540850)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 562337
GRCz11 19 562146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGAAGGTGAACTTGCTGACGGAGAAGCTSAAGGAGCTGGAGGAGGGCT[T/A]GATTGTCATGCAGAAGGACCAGGAGTTGCAGAAGGAGCTKTTGTGTAGCT
Long Flanking Sequence:
AGAGGAGCTGCAGGAGTGTGTGGAGGAGAAGGACCGGGAGCTCCGAGCCTGCAGGATGAGGGTGGAACAAGCTCAAACTGATGCCCACGGACTGTACGATAAAGTGGCTCAGCTTGAGGACAATCTCAGGGAGAAAGTGGCTGCCGTTTTGGTCAGTCAAGCACAACTGGAAGCCGTTCAGACGCAAACCAAAGAGCTCCACGCTGAGGCTATAGTAGGCTCCGGAACACAGCTGCAAGAGGGCATCTGGATGCAGGATGATCTAATGGCACAGGTGGGCCTCAGGGTGCAGAAGAGCCTCAGGATGCAGGAGGATTTCACTGTGCAGGAGGGCCTTGAGGTGCAGGAGGGTCGAACGACGCTGGAGGGCCTCACAGTACAGGAGGGTCTCACAATGCTGCCGGGCCTCACAATGCAGGAGGGCTTCAGGGCGCAGGCTAAAGCCTCTGGAGGGAAGGTGAACTTGCTGACGGAGAAGCTGAAGGAGCTGGAGGAGGGCT[T/A]GATTGTCATGCAGAAGGACCAGGAGTTGCAGAAGGAGCTGTTGTGTAGCTCTGAGGAGGAGGTGATGGAGTATGAGAGCAGGTTATCCGTCATGATGGACCTGCTCAGCCAGATGAAAACCAAACCCAGCGCTCTCAGACCACTGCCGTCGTCTCAGGTGAGTCTTTGCTGCCTGGTCGCCATGCACGACTAGTGTGAATGATGTTTAGAGGAGTCTCTGGTGTTAGTGTGAGTCCCTGTGGTGTTTGCATGAGTCTCTGTGGTGTTTGCATGAGTCTCTGTGGTGTTTGCATGAATCTCTGTGGTGTTTGCATGAGTCTCTGTGGTGTTTGCATGAATCTCTGGGGTGTTTGCATGAGTCTCTGTGGTGTTTGCATGAATCTCTGGGGTGTTTGCATGAGTCTCTGGGGTGTTTGCATGAGTCTCTGTGGTGTTTGCATGAATCTCTGTGGTGTTTGCATGAATCTCTGGGGTGTTTGCATGAGTCTCTGTGGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43191
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Essential Splice Site 949 2229 9 30
Genomic Location (Zv9):
Chromosome 19 (position 543685)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 565172
GRCz11 19 564981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGACAGAGAGATGAGTCTGGCTCTGCTGAAGGATCAGCTAAACCGGG[T/C]GAGTGGATATACACCTATAATCATTATAAAGTACATGCAGATACTCATAT
Long Flanking Sequence:
TGTACTTCCAACTGAAACTGAATATTGAGTAGGGGCGGGGCTTAATTTCAGTAGGTTAATGTACTTCCAACTGAAACTGAATATTGAGTAGGTGCGGGGCTTAATTTCAGTTGGTTAGTGTACTTACAACTGGAACAGAAAAATTGTGTAGAGGCGGGGCTTTCTCTAGCACATCATTCCCTTATAGCAAACTAAAGGTAAGAGAGGGTATTGATATGCAGTTGCTATGGAAACCCTCAGGGTGACATCAGCAGAAGGAGCAAATACAAACGCAGAAGCAAATGCTCAGACTTTCATTGAAGATTACCAAAATAAATACATTCCTTCAGTAAATTAACTTGCGCTGATTAATTATTCAGCTTTTGAATAACAACGTGAGCTAGCAGAATAAACAGTGTAGATTTAGATTTCAGACGGACTTTAAAACTGTGTGTGTGTGTGTGTGTGTGCGCAGGACAGAGAGATGAGTCTGGCTCTGCTGAAGGATCAGCTAAACCGGG[T/C]GAGTGGATATACACCTATAATCATTATAAAGTACATGCAGATACTCATATTGTGGACACTTACAGTAAATAATCATCAGTGTTTAGACTTGTTTTTAAGAGTGTTCAGAGTGTATTTGCAGTGGTGTTCATAACAGACCAGTTCTAGGAGATTTCATTGGTTAATTAGCTTAACAATTCAAACATCATGATGTTAATCTGAACAAATATTGACTATTGTGTGACTGTTTATAGAGCTGTTGTACATCAACACTGTGCAGTAAAGCTCCACTAGTTGACATTAAGCTGAACTAAACTCACTTTTATTCATCTTTACTGATGTGAATTTTTATTTAAAGTCTAATCATGCATTCAAGTCATAATCATAATCTGATTACCAGAGTCAGAATTGTTTTATTAAATGCATTTAATAATTAATAACATTTTTAAGTAATAAAATGAACTCATATTAAAGCAGTATATCTATTAAATCAGCTTTTCTCACTGATTTTAATGCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36744
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 1513 2229 17 30
Genomic Location (Zv9):
Chromosome 19 (position 551126)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 572613
GRCz11 19 572422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTGAACTGAACCACACTAAACTAGAGCTGGAGAGCGCTCTGAACACA[C/T]AACACACACACCTGAGGGAGCTTGACACACTCAGGTAACGCACACGCGCG
Long Flanking Sequence:
ACACTCATCACTGCGGTCGTCTGTTCTGGGAGTGATGTTTACTTCTGTTCTCATCAGGAATGCTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCCGGAGGAGAGGCTGTTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCCGGAGGAGAGGCTGTTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCCGGAGGAGAGGCTGCTGAGCTCTGATAGGCCGGAGGAGAGGCTGTTGAGCTCTGATAGGCTGGAGGAGAGGCTGCTGAGCTCTGATAGGCCGGAGGAGAGGCTGCTGAGCTCTGATAGGCTGGAGGAGATGAAGTCTGAACTGAACCACACTAAACTAGAGCTGGAGAGCGCTCTGAACACA[C/T]AACACACACACCTGAGGGAGCTTGACACACTCAGGTAACGCACACGCGCGCAATACAATACTTGCAGACATCTGAACGAGCTCAACACACTCCGATAACAAACACACACACACGTACTTGTGACATACACAAACACACACCTTAAAGAGCTGGTAACATGCACACTTTGGTAACACAGATGCAAAACACACACCTGAGGGAGCTCGACACACTCGGGTAACAGACAATAAAATGCAAAACAACACACACACACACACACTCGGATAGCACACACACACACGACACATACACTACAAACATCTGAATATAGTAACATATTCGGGTAACACAGATGCACAACACACACACACACACACTTATGTGACACACACACCTGACAGAGATTGATACACTCAGGTAATACACATATACTTCTTACAAACACACACACACACACCTAAAAGAGCTGGTAACATGCTCACTCAGGGAACACACGTGCACAACACACACACACGCACTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29113
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Essential Splice Site 1673 2229 20 30
Genomic Location (Zv9):
Chromosome 19 (position 553690)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 575177
GRCz11 19 574986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTGGGACGCAGAACACACTCCTGGAGGCCGAAGCCACCTGCAGCCAG[G/A]TGAACAAAGACACGCACACATGGACGGAACCAAACCATTGCATTTTTTCC
Long Flanking Sequence:
AGCAACAGCAACACCTTAACAACATCATAGCAATGTTCTAGCAACCACTTGGAACACCCTGGCAACAGCAACACCTTAACAACAGCATAGCATTGTCTTAACAACATTATAACAATGTACTAGCAACCACTTAGAACACCCTAGCAACACCCTTACAACAGCATAGCAACGTATTACAAATACTCGAGCATTACATATATTGTGTTACTGTCACAGCTCAGTGAATGGGTGTTTACAATGATTGTGTGTTTATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACAGGTTCAGTTAGACGCTCAGAGGGCTCGATGCGCAGAGCTCAGCGGCGCTCTAGAGAAGGAGAAACAGCTCAACACACAGCTGATCCAGCGCTTCCAGAGCGGCTCCTCAACACACACACTGCCTTCTGGGACGCAGAACACACTCCTGGAGGCCGAAGCCACCTGCAGCCAG[G/A]TGAACAAAGACACGCACACATGGACGGAACCAAACCATTGCATTTTTTCCTATCAAATGAAAAGTTTATCCTGCTCAGCACACACGGTTCATCCATAGCTAAAGTAGCTGCAGGGAAACAGAGCTGCTGATGCGGCACACATCCACAACTGCATGATGCTTATGAGGATTTCTAAGTTCATGAATAAATCTGATGCTGTGTTTGGGCTCAGGTGGAGGCCGGAGTGGAGTCGGTGGAGTCTCTGCTGCAGACGCTGCAGTCTCAGCTGATGGAGAAGCAGACGCAGGTGGTGCAGATGATGGAGGAGATGGAGAAGCAGCAGCTGGAGGCGCTGCAGCACAGAAGACAGAGCCAGGAGGAGAGATCCGCCCTCGCCCGCACCGCGGCTGAGCACCAGAGCGCCCTGCAGACGGCCCGCGAGAGCCTGAGAGAGATGCAGAGTCAGCTGCAGGCGGAGAGAGAGAACGGCAGGAGGATGGAGACGGAGAGAGAGAAACTGC
Associated Phenotype:
Not determined